Which prehistorical human developments were most integral to the creation of civilization? Include at least three developments in your discussion.

Answers

Answer 1
Civilizations expand through trade, conflict, and exploration. Usually, all three elements must be present for a civilization to grow and remain stable for a long period of time. Trade
The Khmer maintained vibrant trading relationships throughout East Asia, the Indian subcontinent, and even Europe and Africa through the Silk Road, a collection of both overland and maritime trade routes. The primary conflicts of the Khmer civilization were waged with neighboring communities—the Cham, the Vietnamese, and the Thai. The Cham were a collection of kingdoms in what is today central and southern Vietnam, while the ancient Vietnamese influence extended through what is today northern Vietnam. Thai kingdoms such as Sukothai and Ayutthaya flourished in what are now Thailand, Cambodia, and Malaysia. The Khmer civilization relied heavily on rice farming, and developed a complex irrigation system to take advantage of the rivers and wetlands that dotted their territory. An efficient series of irrigation canals and reservoirs, called barays, allowed fewer farmers to produce more rice. This, in turn, allowed more people to pursue non-agricultural lifestyles and migrate to great urban areas, such as Angkor.

Related Questions

what are the major contemporaries global issues facing the world in the 21st century?​

Answers

there are deadly diseases

Among the many issues facing the world are the growing gap between the rich and the poor, the population's continued rapid growth, and the ongoing destruction of the environment.

What is the contemporary global world?

The term "globalization" is frequently used to describe the shape of the modern world. It implies that we are currently residing in a highly technologically driven, mobile, and hurried society. Since the early 1990s, our modern world's society has gone by the name "globalization."

The focus of Contemporary Issues is on researching the historical antecedents and evolution of domestic and international political and social issues that face modern humanity. The 21st century is rife with problems that affect the entire world community. Some, like the threat of terrorism and the effects of climate change, endanger our very existence, while others, like the debate over gay marriage and other civil rights issues, have the potential to alter how we perceive some of the fundamental interpersonal relationships in contemporary society.

Learn more about the contemporary global world here:

https://brainly.com/question/29614225

#SPJ2

Based on the graph you see here, when did the US birthrate grow most quickly?

between 1935 and 1940

between 1945 and 1950

between 1955 and 1960

between 1965 and 1970

Answers

Answer:

1945 to 1950 was termed the baby boom because of so many births after wwii

Based on U.S. birth statistics, the period in which the birth rate grew most quickly was between 1945 and 1950.

Why did the birth rate grow so quickly?

The United States had just won the second World War and economic prosperity kept increasing.

People therefore felt more secure and economically well-off and this inspired them to give birth to more children.

In conclusion, option B is correct.

Find out more on birth rates at https://brainly.com/question/1851630.

Which position did William b Travis support after 1835

Answers

Answer:A

Explanation:

How did the Declaration of Independence affect Native Americans?
o It stated that Native Americans would have the same rights as Americans if they gave up land.
It allowed them to be free of colonists trying to take their land.
o It allowed them to have a voice in the new government.
o It claimed that Native Americans fought against the United States.

Answers

Answer:

It claimed that Native Americans fought against the United States

Explanation:

The Declaration of Independence listed many greivances about Britain. One of them were that they used "savages" (Native Americans) to attack them during the American Revolution

Please add Brainliest if you found this helpful

Introduction: Place the events of Alvarez v. United States in the correct order.
US Court of Appeals overturned
Alvarez was accused of violating Supreme Court declared "Stolen Alvarez claimed he was awarded
his conviction
"Stolen Valor Act"
Valor Act" unconstitutional
the "Medal of Honor

Answers

Answer:

Alvarez claimed he was awarded

Alvarez was accused of violating

US court of appeals overturned

Supreme Court declared

Explanation:

Sorry I was too lazy to type the full things but like this is the answer

Answer: 1. Alvarez claimed he was awarded the "medal of honor" 2. Alvarez was accused of violating "Stolen valor act" 3. US court of appeals overturned his conviction. 4. Supreme court declared "stolen valor act"

Select the correct answer from the drop-down menu. _____________ is the idea that all citizens, as well as their leaders, are equal and subject to the same requirements.

Answers

Answer:

Equality

Explanation:

That what it be

why did hitler hate the communists (HELP FAST)

Answers

Answer:

Explanation:

Because he didn't want too see them why we playiij ng

How did the French and Indian War lead to tensions between England and its
colonies?
A. The colonists began charging England higher prices for war
materials.
B. England refused to protect the colonists in future wars.
C. England began taxing the colonists to pay for the cost of the war.
D. The colonists refused to buy manufactured goods from England,
SUBMIT

Answers

Answer:

c

Explanation:

The answer to this question is C

Does anyone know this?

Answers

Answer:

Large scale irrigation and water-control projects were instituted for the first time in China during the Zhou dynasty period. This greatly increased crop yield, and government was able to store surplus food and distribute it in times of famine or bad harvest

Explanation:

Help me thank u !!!!!!!

Answers

Answer:

The answer is C

Explanation:

Hope this helps <3

have a nice day and can you mark me brainliest plz? :)

Another name for the Loyalists would be the Whigs. The Whigs wanted to stay with Britain. So, in turn, your answer here would be C. Have an amazing day!!

will mark brainlist
How did American independence affect women?

It gave women rights equal to those of men.

It gave women a larger role in government.

It failed to give women rights or protections.

It guaranteed that women would be protected from mistreatment.

Answers

Answer:

Explanation:

The  answer is C.

You should look up Abagail Adams and her  letter to John Adams as he wrote the Constitution (late 1700s). It is scathing: she was way ahead of her time. The spelling and grammar left something to be desired, but the thinking did not. I would have been trembling in my boots if I were Adams and he had come home after not addressing any of her concerns.

Women had no political rights until 1920 when the 19th amendment was ratified by congress. That was 3 years behind Canada.

Air is exhaled from a person's lungs into
a balloon and then the balloon is popped.
What best explains what happens to the
air after the balloon pops?
A. It returns to the shape of the person's lungs.
B. It stays in the shape of the balloon.
C. It becomes a liquid, then a solid.
D. It spreads out randomly into the atmosphere.

Answers

D. It spreads out randomly into the atmosphere

Under the Articles of Confederation, Individual States had the ability to
A)Tax Citizens
B)Have their own Militias
C)All of the above

Answers

Answer:

All of the above

Explanation: I just took a class on it

All above is the answer

Summarize Hollywood in the beginning

Answers

Answer: Harvey Wilcox, a Kansas prohibitionist, laid out Hollywood as a subdivision in 1887. H.J. Whitley, a real estate magnate, transformed Hollywood into a wealthy and popular residential area. Hollywood was established as a municipality in 1903 and was incorporated into the city of Los Angeles in 1910.

Explanation: I phrapsed it cause  it cause I don't want your teacher to think you cheated but hope that helps

Muslim soldiers believed they had a _____________ to spread Islam..

Answers

Answer:

Muhammad

Explanation:

Am very good at this its easy

What was the purpose of the Proclamation of 1763?

1. to force colonists to trade with Britain

2. to stop American colonists from settling in the Midwest

3. to close the harbor in Boston

4. to force colonists to pay for protection from British soldiers

Answers

anwser: to stop American colonists from settling in the Midwes

Explanation: i got it right

How did the Georgians viewed the american revolutionary war?​

Answers

Answer:

When violence broke out in 1775, radical Patriots (also known as Whigs) took control of the provincial government, and drove many Loyalists out of the province. Georgia also served as the staging ground for several important raids into British-controlled Florida

1. What is the main goal of conservation groups in the Southwest?

Answers

Answer:

The main goal of conservation is too give a good life and help kids and adults with what they need. Conservation means to save or to protect something from being finished, destroyed or to be extinct. So basically with animals and people. That's a main goal of conservation in the groups within the Southwest.

Explanation:

Good luck, I hope this helps.

What advantage did the colonists have during the American Revolution?

more belief in their cause

more reasons for African Americans to join their fight

more experienced soldiers

more support from Native Americans

Answers

Answer:

Advantages the helped the Americans win the Revolutionary War include: better leadership, foreign aid, knowledge of the land, and motivation.

Unlike Plato, Aristotle believed in:

Answers

Ideal form of govt balanced monarchy,aristcracy,and democracy in one system

help meee I been stuck on this for the past week

Answers

Answer:

c

Explanation:

im pretty sure it is c

What was the significance of the Mayflower Compact to the American colonies?

It established a constitutional monarchy.

It established the idea of self-government.

It gave colonists the right to elect members to Parliament.

It emphasized the rule of the governor over law and tradition.What was the significance of the Mayflower Compact to the American colonies?

It established a constitutional monarchy.

It established the idea of self-government.

It gave colonists the right to elect members to Parliament.

It emphasized the rule of the governor over law and tradition.

Answers

Answer:

It established the idea of self-government.

Explanation:

This was literally the first-ever constitution in North America. The crew of the Mayflower thought they needed a government to prevent instability, so they established a government separate from England's.

Answer:

It established the idea of self-government.

Explanation:

i’ll give brainliest

Answers

Answer:The unanimous Declaration of the thirteen united States of America, When in the Course of human events, it becomes necessary for one people to dissolve the political bands which have connected them with another, and to assume among the powers of the earth, the separate and equal station to which the Laws of Nature and of Nature's God entitle them, a decent respect to the opinions of mankind requires that they should declare the causes which impel them to the separation.

We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness.--That to secure these rights, Governments are instituted among Men, deriving their just powers from the consent of the governed, --That whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it, and to institute new Government, laying its foundation on such principles and organizing its powers in such form, as to them shall seem most likely to effect their Safety and Happiness. Prudence, indeed, will dictate that Governments long established should not be changed for light and transient causes; and accordingly all experience hath shewn, that mankind are more disposed to suffer, while evils are sufferable, than to right themselves by abolishing the forms to which they are accustomed. But when a long train of abuses and usurpations, pursuing invariably the same Object evinces a design to reduce them under absolute Despotism, it is their right, it is their duty, to throw off such Government, and to provide new Guards for their future security.--Such has been the patient sufferance of these Colonies; and such is now the necessity which constrains them to alter their former Systems of Government. The history of the present King of Great Britain is a history of repeated injuries and usurpations, all having in direct object the establishment of an absolute Tyranny over these States. To prove this, let Facts be submitted to a candid world.

He has refused his Assent to Laws, the most wholesome and necessary for the public good.

He has forbidden his Governors to pass Laws of immediate and pressing importance, unless suspended in their operation till his Assent should be obtained; and when so suspended, he has utterly neglected to attend to them.

He has refused to pass other Laws for the accommodation of large districts of people, unless those people would relinquish the right of Representation in the Legislature, a right inestimable to them and formidable to tyrants only.

He has called together legislative bodies at places unusual, uncomfortable, and distant from the depository of their public Records, for the sole purpose of fatiguing them into compliance with his measures.

He has dissolved Representative Houses repeatedly, for opposing with manly firmness his invasions on the rights of the people.

He has refused for a long time, after such dissolutions, to cause others to be elected; whereby the Legislative powers, incapable of Annihilation, have returned to the People at large for their exercise; the State remaining in the mean time exposed to all the dangers of invasion from without, and convulsions within.

He has endeavoured to prevent the population of these States; for that purpose obstructing the Laws for Naturalization of Foreigners; refusing to pass others to encourage their migrations hither, and raising the conditions of new Appropriations of Lands.

He has obstructed the Administration of Justice, by refusing his Assent to Laws for establishing Judiciary powers.

He has made Judges dependent on his Will alone, for the tenure of their offices, and the amount and payment of their salaries.

He has erected a multitude of New Offices, and sent hither swarms of Officers to harrass our people, and eat out their substance.

He has kept among us, in times of peace, Standing Armies without the Consent of our legislatures.

He has affected to render the Military independent of and superior to the Civil power.

He has combined with others to subject us to a jurisdiction foreign to our constitution, and unacknowledged by our laws; giving his Assent to their Acts of pretended Legislation:

For Quartering large bodies of armed troops among us:

For protecting them, by a mock Trial, from punishment for any Murders which they should commit on the Inhabitants of these States:

For cutting off our Trade with all parts of the world:

For imposing Taxes on us without our Consent:

For depriving us in many cases, of the benefits of Trial by Jury:

For transporting us beyond Seas to be tried for pretended offences

 

Explanation:

Entrepreneur (in own words)

Answers

Answer:

A person who starts a business and is willing to risk loss in order to make money.

Explanation:

Can i get brainliest plz

List and describe any 5 facts about the 13 Colonies. List the
colony and describe the facts about that colony.

Answers

Answer:

Connecticut enacted the first constitution in America. ...

Maryland was founded as a haven for Catholics. ...

Massachusetts was the birthplace of the American iron industry. ...

Pennsylvania was created to pay a debt. ...

New Jersey had the alternate name of New Caesarea.

Explanation:

how have immigration policies changed throughout history in the us

Answers

Americans encouraged relatively free and open immigration during the 18th and early 19th centuries, and rarely questioned that policy until the late 1800s. After certain states passed immigration laws following the Civil War, the Supreme Court in 1875 declared regulation of immigration a federal responsibility.

All of the animals listed below are usually found in the same geographic region as the animals shown in the photos above
except
A. rabbits
B. coyotes
C.
D. elk
raccoons

Answers

Answer:

Its

Explanation:

Did theatre benefits from the movement of drama out of the church???

Answers

Answer:

yes

Explanation:

what are 10 examples of historical evidence​

Answers

Printed sourcesOral testimonyPhysical evidence. artifactsprimary sources secondary sources inscriptionsdocumentsletters

literary texts  

Hope that helps

Use the information to answer the question.

We hold these truths to be self-evident, that all men are created equal. . . .

Which group in revolutionary-era America was excluded from this ideal?

Answers

Answer:

Explanation:

Hi weys xd

Natives, slaves, and/or women
Other Questions
How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday which individual from the renaissance was one of the earliest artists to paint rounded, lifelike figures in natural settings? 5 by 8 of the children in the field are girls. There are 45 boys. How many girls are there?