what was the year of establishing US?

What Was The Year Of Establishing US?

Answers

Answer 1

Answer:

1776

Explanation

In 1776, in Philadelphia, the Second Continental Congress declared the independence of the colonies as the "United States". Led by General George Washington, it won the Revolutionary War. The peace treaty of 1783 established the borders of the new nation.

please give brainliest plz follow

Answer 2

Answer:

the year in which us establishing of US

is 4 july 1776....


Related Questions

The manor system provided peasants not only protection from invaders but also

Answers

Answer:

The Manor System or Feudalism provided little to no protection to peasants from invaders, but they were obligated to work and fight for his Liege Lord, regardless of his choices. There was no liberty for the peasants.

Explanation:

The Feudal System is very unequal, unfair and exploratory of its subjects. Most of them worked hard on the fields, with no pay and only the guarantee of a roof and food on his table.

The endless taxes and obligations that feudal subjects need to oblige, to make the life of the nobility so high standard and so lush, with endless food and resources for construction of castles, to waging wars and conquests.

In war times, the peasants are not taken into protection, as vividly as the ones in the upper class. Priority goes all to the nobility and the clergy. Those who are at the top, survive the raids, sacks and horrors of battle, while the peasants suffer and die at the hands of the attackers. Armies are, most of the time, arranged in a way that the first ones to battle and die are the peasants. They are called “cannon fodder” now a days. “Cannon Fodder” meaning expendable soldiers.

The Feudal system served to maintain the culture of Kings, Queens and Empires, exploring the minorities and destroying/conquering its neighbors and “inferiors”, to soul serve its particular economic and status interests.

Your answer should be ???→  not only protection from invaders, but also. ease and relaxation.

Is that right

Which of the following is the best example of technology?
o
A. The education required for a modern job
O B. The mechanical equipment used to produce something
O ооо
C. The increasing speed of communication
D. The trade of goods between different regions
SUBMIT

Answers

Answer:

B. the mechanical equipment used to produce somethin

Explanation:

The Virginia Company established the House of Burgesses to

Answers

Answer:

Explanation:

July 30, 1619

100 points

What are some of the consequences of coastal erosion in Louisiana? Check all that apply.

a loss of transportation routes due to flooding
a loss of wetland areas as the land wears away
a rise in poor air quality due to diesel emissions
a rise in poor water quality due to contamination
a need for restoration projects to reclaim certain areas
an increase in silt deposits in certain areas due to flooding

Answers

Answer:

1,2 and 5

Explanation:

What cuts the world into the Northern and the Southern Hemisphere?

Answers

Answer:

The Equator, or line of 0 degrees latitude, divides the Earth into the Northern and Southern hemispheres. ... The prime meridian, or 0 degrees longitude, and the International Date Line, 180 degrees longitude, divide the Earth into Eastern and Western hemispheres.

Answer:

The Equator, or line of 0 degrees latitude, divides the Earth into the Northern and Southern hemispheres.

hope this helps <3

Which of the following ecozones includes the United States?
A. Nearctic
B. Australasia
C. Neotropic
D. Antarctic
SUBMIT

Answers

Answer:

Nearctic - A

What was Peter Olive's address about

Answers

Answer:

An Address to the Soldiers of Massachusetts Bay who are now in Arms against the Laws of their Country.

Explanation:

Who sold the Louisiana Territory to Thomas Jefferson, more than doubling the size of the United States?

Queen Victoria- Britain

Napoleon Bonaparte-France

Joseph I- Spain

Otto Von Bismarck-Germany

Answers

pretty sure it was Napoleon

Napoleon Bonaparte sold the land because he needed money for the Great French War. The British had re-entered the war and France was losing the Haitian Revolution and could not defend Louisiana.

Napoleon Bonaparte-France the Louisiana Territory to Thomas Jefferson, more than doubling the size of the United States

Why did Napoleon market French land to the United States?

Napoleon Bonaparte traded the land because he required money for the Great French War. The British had re-entered the war and France was failing the Haitian Revolution and could not support Louisiana.

What land did we buy from Napoleon?

The Louisiana Purchase encompassed 530,000,000 acres of territory in North America that the United States purchased from France in 1803 for $15 million.

Why did the Napoleon need money?

Napoleon was clearly in lack of funds to prosecute his ongoing wars with Britain and other European powers, and the sale of land to the United States did supply some revenue for him; but it was more of a "fire sale" than anything else

To learn more about Napoleon Bonaparte, refer

https://brainly.com/question/18538244

#SPJ2

las aves respiran con

Answers

Answer:

el aire pasa a través de pequeñas aberturas en forma de fosas nasales en el pico llamadas narinas.

What made the civil rights act significant ? 

Answers

The Civil Rights Act of 1964, which ended segregation in public places and banned employment discrimination on the basis of race, color, religion, sex or national origin, is considered one of the crowning legislative achievements of the civil rights movement.

The Virginia House of Burgesses was the first:

Answers

I believe the answer is A. Good luck with that class

Which of these lines is an example of hyperbole?

A) Are fleets and armies necessary to a work of love and reconciliation?
B) An appeal to arms and to the God of Hosts is all that is left us!
C) Gentlemen may cry, Peace, Peace, but there is no peace.
D) But when shall we be stronger? Will it be the next week, or the next year?

Answers

Answer: B
Your welcome:)

Answer:

B) An appeal to arms and to the God of Hosts is all that is left us!

Explanation:

An appeal to arms and to the God of hosts is all that is left us! They tell us, sir, that we are weak; unable to cope with so formidable an adversary. But when shall we be stronger? Will it be the next week, or the next year?

IF YOU HAVE ANY QUESTIONS LMK~!!!

Ponce de Leon accompanied _____ on one of his voyages.

George Washington
Christopher Columbus
John Smith

Answers

Answer:

Christopher Columbus

Explanation:

Born into Spanish nobility, Juan Ponce de León (1460-1521) may have accompanied Christopher Columbus on his 1493 voyage to the Americas.

The answer is B - Christopher Columbus.

Explanation:

Spanish sources asserted that the Taino Indians of the Caribbean also spoke of a magic fountain and rejuvenating river that existed somewhere north of Cuba.

These rumors conceivably reached the ears of Ponce de León, who is thought to have accompanied Christopher Columbus on his second voyage to the New World in 1493.

Why did Mexico lose half of their nation to the United States of America?

Answers

Answer:

The Treaty of Guadalupe Hidalgo, signed in February 1848, was a triumph for U.S. expansionism under which Mexico ceded nearly half its land. The Mexican Cession, as the conquest of land west of the Rio Grande was called, included the current states of California, New Mexico, Arizona, Nevada, Utah, and portions of Colorado and Wyoming.

Explanation:

can u use distance in a sentence

Answers

Answer:

He wants to put distance between himself and his former employee.

Name the members of the Virginia Dynasty and one thing from his term in office that he is remembered for.

Answers

Answer:

George Washington, Thomas Jefferson, James Madison, and James Monroe. But the main one was Washington because he is rightly remembered as the Father of his Country.

The members of the Virginia Dynasty - George Washington, John Adams, Thomas Jefferson, James Madison.

What is Virginia Dynasty?
Four of the founding five presidents of the USA were from Virginia, which is referred to as the "Virginia dynasty" in some circles. The term occasionally leaves out George Washington, a Virginia planter who supported the Federalist Party's agenda and was succeeded as president by Massachusetts' John Adams. George Washington, John Adams, Thomas Jefferson, James Madison, & James Monroe were the first five presidents, in that order.

George Washington- he is remembered for being the first president and for being the "Father of the Country"
John Adams- he is remembered for being the second president and for being a founding father
Thomas Jefferson- he is remembered for being the third president and for being the "Father of the Declaration of Independence"
James Madison- he is remembered for being the fourth president and for being the "Father of the Constitution"

To learn more about Virginia Dynasty
https://brainly.com/question/14380497
#SPJ2

house taken over is?​

Answers

Your answer is -Casa Tomada

D. What process created the Hawaiian Island chain?

Answers

Answer: The Hawaiian Islands were formed by a volcanic hot spot,

Explanation:When the vocano explodes the vocano's magma melts out and over days, weeks,or years the magma hardens and creats new islands!!

Christianity originated in the Roman province of
O Judaea
O Babylon
Asia Minor
O Assyria

Answers

Answer:

9kfuryhtgrfedwsxaasdfghjukiy

Explanation:

In the province of Judea

Explain how yellow journalism was a cause of the Spanish -American war

Answers

Answer:

Yellow journalism was a style of newspaper reporting that emphasized sensationalism over facts. During its heyday in the late 19th century it was one of many factors that helped push the United States and Spain into war in Cuba and the Philippines, leading to the acquisition of overseas territory by the United States.

Explanation:

George Washington was born in _____ .

Virginia
South Carolina
West Virginia

Answers

Answer:

George Washington was born in Virginia....

Groups of soldiers are called what

Answers

a group of soldiers is called an army

arming was the principal activity

Answers

Answer:

you need to add more info to your question if you want to get a good answer

Explanation:

The World War II strategy used by the US for attacking Japan was called what

Answers

Answer:

Explanation:Leapfrogging :)

introduced about settlement​

Answers

Answer:

In geography, statistics, and archaeology, a settlement, locality, or populated place is a community in which people live. ... Settlements may include hamlets, villages, towns, and cities. Settlement refers to the cluster of houses over space which manifests the socioeconomic conditions and the environmental constraints.

Explanation:

as above

Answer:

this is

Explanation:

mark me brainlist ok

What type of transportation was only used over short distances?
A. Turnpikes

Answers

Answer:

Horsecars

Explanation:

Hope it Helps

Peace out

^^ ^-^ :) ;) ~-~

How does free trade most affect specialization?
A. Free trade encourages specialization because competition leads
each country to concentrate on the things it does best.
B. Free trade punishes specialization because countries with only
one or two products cannot overcome trade restrictions.
C. Free trade discourages specialization because the lack of trade
barriers results in every country getting involved in all aspects of
trade.
D. Free trade encourages specialization because tariff barriers are
lifted on just a few selected products that other countries want.

Answers

Free trade encourages specialization because competition leads each country to concentrate on the things it does best (option a).

In a free trade environment, countries are able to engage in international trade without significant barriers or restrictions. This promotes competition among countries, encouraging them to focus on their comparative advantages and specialize in the production of goods and services in which they have a competitive edge.

When countries specialize in producing goods or services that they can produce efficiently and at a lower cost compared to other countries, they can achieve higher levels of productivity and efficiency.

Specialization allows countries to allocate their resources more effectively, as they can concentrate on the areas where they have a comparative advantage, such as access to certain natural resources, skilled labor, or advanced technology.

By specializing, countries can maximize their production capabilities and output, leading to increased efficiency and economic growth. Specialization also facilitates the exchange of goods and services between countries, allowing them to benefit from the principle of comparative advantage, where each country focuses on producing what it does best and trading for goods that it cannot produce as efficiently.

Overall, free trade encourages specialization by creating a competitive environment where countries can concentrate on their strengths, leading to increased productivity, efficiency, and economic gains for all participating nations.

For more such questions on trade, click on:

https://brainly.com/question/28827880

#SPJ8

1. Compare 2010 voter statistics for African Americans, Hispanics, and young Americans with the political outcomes in Congress for that year. What do you notice about voter turnout for these groups and how it affects which party has majority power? (10 points)

Answers

Answer:

During the 2010 election there were members  from different group of young clique and minorities partaking during the election year. Also,these groups were up in voter turn out, it happened that there was a majority democratic senate and a majority democratic house. These same groups were still up and the president was elected. Former president Barack Obama was the democratic candidate.

Explanation:

give me brainliest answer pls

Which one of these Amendments: 16th,17th, 18th, or 19th do you think has been the most important for the American people since it was passed? Why?

Answers

Answer:so you need to slwwo

How did the United States raise most of the funds needed to pay for the war? (5 points) a through taxes on income and certain goods b through the sale of war bonds c through loans from Allied powers d through mass production in industries

Answers

Answer: through taxes on income and certain goods

Explanation:

In th 198908 on continual day
Other Questions
It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday which individual from the renaissance was one of the earliest artists to paint rounded, lifelike figures in natural settings? 5 by 8 of the children in the field are girls. There are 45 boys. How many girls are there? which pair of alternatives is highlighted by the life cycle of the cellular slime molds, such as dictyostelium? 6.How does the organization of this text help the reader understand theargument? in the upper limb, the brachial artery can be found ___________.