quien me puede decir las pergunas de la página 19 de libro de geografía porfa​

Quien Me Puede Decir Las Pergunas De La Pgina 19 De Libro De Geografa Porfa

Answers

Answer 1
Yo no se to pa nada !!!

Related Questions

What physical features are significant in the locations of the major cities of Europe?

Answers

Answer:

k and 5 +k5

Explanation:

ju ju

The physical features are significant in the locations of the major cities of Europe are mountains, landforms, and river.

What is cities?

The term “cities” refers to a place with a small population, but all facilities are included. A city is a place located in the geographical center. The city's amenities include parks, infrastructure, and buildings. The cities are the less rural area and more urban areas. The city's advantage is that all facilities are easily available.

The physical features are significant in the locations of the major cities of Europe are:

The Mountains such as Apennines, Balkans, Carpathians and Alps. The landforms such as Western Highlands, Central Uplands, Alpine region, and Northern Lowlands.The Rivers such as the Danube River and  Rhine River.

As a result, the physical features of major cities of Europe are mountains, landforms, and river.

Learn more about cities, here:

https://brainly.com/question/24476050

#SPJ2

which group of factors are most important in determining the composition of ocean water?

Answers

Answer:

The temperature and salinity of seawater influence its density. Temperature and salinity vary with latitude. Therefore, the density of seawater also varies with latitude.

Answer: Temperature, salinity and density.

Hope this helps! :)

need help with both questions pls but if you can only answer one that’s fine ! WILL MARK BRAINLIST !!

Answers

We can’t answer it… doesn’t have a question

the difference between hornfels and soapstone is that

Answers

Soapstone can be scratched by a fingernail and hornfel cannot and Soapstone is foliated and hornfel is unfoliated

describe three major environmental challenges facing oceania.

Answers

Answer:

greenhouse gas, ocean floor drilling and coastal erosion.

Answer:

Responses may vary but should include some or all of the following information:

(Students may identify issues such as deforestation and drought. They also may address an increase in the numbers of endangered species. They could address atmospheric issues such as changes to the Earth’s ozone later. Finally, they may address the effects of nuclear testing on many Pacific Islands.)

Explanation: EDGE 2022

What are the coordinates of Garden City, Kansas?A.N 37°55ʹ, W 100°50ʹB.N 39°46ʹ, W 95°5ʹC.N 38°58ʹ, W 99°52ʹD.N 39°21ʹ, W 99°50ʹ

Answers

Answer:

The Answer is 37.9717 N, 100.8727 W

Explanation:

This is the exact coordinates of  Garden city Kansas so try to get the closest one

Answer:  A 37,55  100,50

Explanation:

what does clay contains

Answers

Answer:

Explanation:

Clay has a high content of clay minerals that give it its plasticity. Clay minerals are hydrous aluminum phyllosilicate minerals, composed of aluminum and silicon ions bonded into tiny, thin plates by interconnecting oxygen and hydroxide ions.

In what ways has geography affected settlement patterns in North Africa?

Answers

Geography of the region shaped the way of life of the people living there. The people in the forests could grow taro, yams, and kola and trade it for gold and sold. The people in the desert could move herds of cattle, sheep, and goats to find food and water.

what causes the shaking that is associated with earthquakes?

Answers

Answer:

The tectonic plates are always slowly moving, but they get stuck at their edges due to friction. When the stress on the edge overcomes the friction, there is an earthquake that releases energy in waves that travel through the earth's crust and cause the shaking that we feel.

Explanation:

the tectonic plates

All of the following are major industries based on the natural resources of Australia EXCEPT

A. forestry

B. mining

C. desertification

D. tourism

Answers

Answer:

jsjsjejeiwbisjeiejsusisjsbsjsiisjsjsjsjsjsjssjsjjsjsC . desertification

What do these caste divisions say about society in the region for India?

Answers

Answer:  The Indian society is divided into various sects and classes. This is because of the caste system which is prevalent in the country. The roots of the caste system go back to the ancient Vedas dividing people on the basis of varna or occupation. It has brought many evils in the society.

Explanation:

new york and london are on two separate plates so the distance between the cities is ________.

Answers

3451 miles / 5555 kilometers / 2999 nautical miles.

14. The arrival of a million people to Canada from Great Britain between 1815 and 1844 caused an
increase in
A. French nationalism.
B. Quebecois.
C. French-speaking citizens.
D. Loyalists.

Answers

Answer:

..

Explanation:

The arrival of a million people to Canada from Great Britain between 1815 and 1844 caused an increase in D.

Loyalists. During this period, a significant number of British settlers migrated to Canada, mainly due to factors such as economic opportunities, political stability, and the promise of free land. These settlers were known as Loyalists, as many of them had remained loyal to the British Crown during the American Revolution and sought refuge in Canada after its conclusion.

The influx of Loyalists contributed to the growth of British influence in Canada and helped shape the country's political, social, and cultural landscape during that time.

Learn more about Loyalists here

https://brainly.com/question/2412874

#SPJ2

I NEED HELP PLEASE In 3–5 sentences, analyze how scientists use many different types of data to predict and help fight wildfires.(4 points

Answers

Answer:

Scientists create computer models to predict wildfire potential under a range of potential climate futures. Using different projections of temperature and precipitation, scientists predict where and when wildfires are most likely to occur. These areas, then, can be managed especially to lower the chances of wildfire.

First correct answer gets brainliest (50) points)
Due to its mix of Spanish and Aztec heritage, Mexico is a perfect example of

cultural appropriation

cultural genocide

cultural diffusion

cultural decimation

Answers

i believe it’s cultural diffusion bc that is the mixing of different cultures and the first two are negative meanings and the last one doesn’t make sense.

12. Which type of industry is textiles?
O
primary industry
secondary industry
tertiary industry

Answers

Answer:

it is under secondary industry

________ tend to increase the explosive potential of a magma body beneath a volcano.

Answers

Answer:

High viscosity and lots of dissolved gas

how can sedimentary rocks become metamorphic rocks

Answers

Answer:

when it gets high pressure

what do contour lines represent on a topographic map

Answers

Answer:

mmmmmmmmm

Explanation:

Answer:

Represent the elevation/steepness

Explanation:

How have people adapted to meet the challenges of the anctarctica circumstances

Answers

Answer:

How do people survive in Antarctica in the winter? Mainly by staying on the station. By not leaving at all during the permanent night, by not travelling for too far and by staying put in a tent or hut if caught out in a blizzard rather than trying to go back to the station.

Explanation:

How are the services industry and postindustrial economy related?

Answers

Postindustrial is an economy where manufacturing is no longer dominant; shifts to service industry. ... People moved out of urban areas when they became crowded.

Scientists claim that this boundary between the Pacific Plate and the Australian Plate is a transform boundary. What evidence would best supports this claim?

Answers

Answer:

its b

Explanation:

how long did it take the astronauts to get to the moon

Answers

three days, three hours and 49 minutes

How hydel power electricity is generated?

Answers

Answer:

Hydroelectric power is produced with moving water

At hydropower plants water flows through a pipe, or penstock, then pushes against and turns blades in a turbine to spin a generator to produce electricity. ... Most U.S. hydropower facilities have dams and storage reservoirs.

What are the three elements of movement

Answers

Answer:

The element of movement are space time and force (energy)

what term specifically describes small chunks of rocks and debris in space that burn up in earth’s atmosphere?

Answers

Meteors sorry if it was wrong :)

Answer:

What term specifically describes small chunks of rocks and debris in space that burn up in Earth's atmosphere? meteors.

Explanation:

Water in the oceans may become freshwater that is available to humans through the processes of:

Answers

Answer:

evaporation, condensation, and precipitation.

Explanation:

Water in the oceans may become freshwater that is available to humans through the processes of evaporation, condensation, and precipitation.

Water is heated to a very high temperature until it evaporates in these methods to kill germs and remove salts that remain after the water has evaporated. The next stage is to condense the (now fresh) water vapor and precipitate it for human consumption.

What is resource conservation​

Answers

Answer:

Resources conservation refers to giving the resources appropriate time to be renewed and using the available resources carefully and when humans balance the use of resources with conservation for coming years is called sustainable development.

Explanation:

hope it helps :)

geographers developed the field of urban geography to study

Answers

Explanation:

In the centuries since, cities have grown so important that geographers have developed the field of urban geography—the study of how people use space in cities.

If you could create a new political party that represented your specific interests and beliefs, what
would your party stand for?

Answers

Answer:    w wwww

rrrrr

Explanation:    wwwww

wwwww

Other Questions
he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday which individual from the renaissance was one of the earliest artists to paint rounded, lifelike figures in natural settings? 5 by 8 of the children in the field are girls. There are 45 boys. How many girls are there? which pair of alternatives is highlighted by the life cycle of the cellular slime molds, such as dictyostelium? 6.How does the organization of this text help the reader understand theargument? in the upper limb, the brachial artery can be found ___________. If a sentence has two subjects but only one verb, that means itA.has a compound subject, but it is not a compound sentence.B.is a complex sentence.C.is a compound-complex sentence.D.is a compound sentence.