ILL GIVE BRAINLIEST, 6 - 10 sentence paragraph telling me the difference between Weather and Climate.

Answers

Answer 1
Weather refers to short term atmospheric conditions, while climate change refers to long term changes. Weather is the day-to-day state of the atmosphere, and its short term variation in minutes to weeks. People usually think of weather as the combination of temperature, humidity, cloudiness, it’s visibility by look , and wind. As an example you wake up in the morning and you are to take a step outside. You look at the sky,it is foggy, that is a representation of the weather for that day. That same weather that you saw might change over the course of the next morning and rain, or you may see a perfect sun, these are all representations of weather and how it is a short term outlook. Climate change is how the characteristics of the weather we experience in a certain place change. 'It can get hotter or wetter on average or have more concentrated rain in a short period, but then get longer dry periods. Although weather does effect our climate it is the weather patterns that cause a long term effect on our daily world.

Related Questions

Which biome do you think had the most biodiversity? Why?

Answers

Answer:

Tropical forests have the highest biodiversity and primary productivity of any of the terrestrial biomes.

Explanation:

study hard

Cells are limited in size by the
a. rate at which substances needed by
the cell can enter the cell through
its surface.
b. rate at which the cell can manufacture
genetic information.
c. amount of material the cell can collect
to fill itself.
d. amount of cell membrane the cell
can produce.

Answers

Answer:

The Answer is A

Explanation:

hope this helps

The human population can maintain an exponential growth rate indefinitely because humans are exempt from population crashes.


True

False

Answers

Answer:

Most likely false

Explanation:

Humans aren't exempt from population crashes, if we spent up our recourses, started wars, etc. It HAS happened before, so most likely false.

what is the difference between sister chromatids and homologous chromosomes?

Answers

Answer:

A sister chromatid refers to the identical copies (chromatids) formed by DNA replication of a chromosome, with both copies joined by a common centromere.

Explanation:

Homologous chromosomes may or may not be the same as each other because they are derived from different parents.

Question 1 (2 points)
What is the molecule that is created in photosynthesis that stores chemical potential energy that is later broken
down into ATP in cellular respiration?
a
plants
b
glucose
с
oxygen
d
carbon dioxide

Answers

Explanation:

In the process of photosynthesis, plants and other photosynthetic producers create glucose, which stores energy in its chemical bonds. Then, both plants and consumers, such as animals, undergo a series of metabolic pathways—collectively called cellular respiration.

Answer:glucose

с

Explanation:

How do cells maintain water balance through osmosis? (Choose 2)
If
salt water fish iS placed in a fresh water aquarium, water will leave the fish's cells.
In the experiment, the only isotonic solution was the 10% salt water solution.
The egg swelled in distilled water because it is hypotonic to the egg's interior.
The concentration of solute iS greater inside the egg than it is in the Kayro syrup.
The egg swells when placed in a hypertonic solution.
(H.B.2C. 2) P

Answers

Answer:

1477

Explanation:

76667

How are a potato, a bacterium, and a human alike?
O They are prokaryotes.
o They are all made of cells,
O They are all eukaryotes,
O They all live in soil,
1
2
3
Please I need help

Answers

Answer:

All made of cells →

Explanation:

The potato, bacteria and a human is alike in the way that they all are made up of cells. The correct option is B.

What is a cell?

Cells are the fundamental cornerstones of all life. Gazillions of cells make up the human body.

They support the body's framework, absorb nutrients from food, convert those calories into energy, and perform specialized functions.

The cell, first discovered by Robert Hooke in 1665, has a rich and interesting history that has led to many of today's scientific advances.

Cell theory is a biological theory first proposed in the mid-nineteenth century that states that living organisms are made up of cells, that cells are the basic structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Thus, the correct option is B.

For more details regarding a cell, visit:

https://brainly.com/question/3142913

#SPJ5

science a:Class B;kingdom c:order or d:phylum​

Answers

Answer:

A. Class

Explanation:

Kingdom can be answered but the most specific is class

how does the phospholipid bilayer form

Answers

Answer:

Being cylindrical, phospholipid molecules spontaneously form bilayers in aqueous environments. In this energetically most-favorable arrangement, the hydrophilic heads face the water at each surface of the bilayer, and the hydrophobic tails are shielded from the water in the interior.

Explanation:

please mark me as the brainliest

have a fantastic day ahead

"Good science" is based on evidence, and results are able to be repeated. *

True

False

Answers

Answer:true

Explanation:

true
explanation: looked it up

Explain the statements:
"all species are highly evolved" and
"all species are mutants"

Answers

Answer:When an animal's genes change, or mutate, the new form of the animal that results is a mutant. One example of such a mutant is a blue lobster.

Explanation:

9th grade biology please help it’s crazy because I’m in 10th grade asking for help on 9th grade work

Answers

Answer:

Mitochondria

Explanation:

They generate most of the chemical energy needed to power the cell's biochemical reactions.

Hope this helps! Sry if I get it wrong!

Answer:

free

Explanation:

How could we model seismic waves in a different way? Come up with another model for this activity and explain the model.

Answers

Answer:

clarify please.

Explanation:

Answer:

Image result for How could we model seismic waves in a different way? Come up with another model for this activity and explain the model.

There are three basic types of seismic waves – P-waves, S-waves and surface waves. P-waves and S-waves are sometimes collectively called body waves.

Explanation:

most glands in the human body are a part of which system?

Answers

Answer:

Explanation:

The endocrine system is made up of organs called glands. Glands produce and release different hormones that target specific things in the body. You have glands all over your body, including in your neck, brain and reproductive organs.

Someone plz help me :(

Answers

The answer to the question is B

Answer:

32

Explanation:

Astrologers relate the location of the stars and planets to events in human lives. Many years ago,people classified astrology as a science. Why do modern scientists consider astrology to be a pseudoscience?

Answers

Answer:

C.

Explanation:

yes, astrology doesn't offer conclusive proof of its claims. astrologers predict the future with the location of planets and stars but they don't have a concrete theory that the location of a particular planet has an impact on human life. they believe in something called universal energy.

But I believe in my god.

how long does it take blood to circulate through the body

Answers

Answer:

1 minute

Explanation:

It takes one minute for blood to circulate from the heart.

The average adult's heart beats 100,000 times per day.

in the overall reactions of photosynthesis, the electrons from _____ are used to reduce _____.

Answers

In the overall reactions of photosynthesis, the electrons from water are used to reduce carbon dioxide.

During photosynthesis, electrons from water molecules are used to reduce carbon dioxide and fix it into carbohydrates while oxygen is produced as a result. The process happens with the help of radiant energy.

Even though the process of photosynthesis is a series of reactions that have been divided into light-dependent and light-independent, the overall equation of the process is written as:

               [tex]6H_2O + 6CO_2 ---> C_6H_1_2O_6 + 6O_2[/tex]

More on photosynthesis can be found here: https://brainly.com/question/1388366

What happens to a population when emigration decreases?

Answers

Answer:

Emigration decreases the population. the answer is B

Explanation:

If the immigration decreases they have no food they they will die out.

Somebody help me please

Answers

Answer: Sterols

Explanation: sry cant really explain

what is the ultimate source of energy for almost all organisms?

Answers

Answer: The sun. The sun fuels all plants which fuels the animals, which fuel people.

Answer:

The sun

Explanation:

What is happening to the growth of a population in which death rate equals birthrate, but emigration is greater than immigration?

Answers

Answer:

Explanation:

A negative growth rate means it is decreasing. The two main factors affecting population growth are the birth rate (b) and death rate (d). Population growth may also be affected by people coming into the population from somewhere else (immigration, i) or leaving the population for another area. i mean

The growth of the population is decreasing.

Growth rate of the population depends upon:-

          -Birth rate

          -Death rate

          -Immigration

          -Emigration

What is emigration?Movement of organism from its residing place to another place.This generally happen because of certain factors like not suitable habitat, occupation, food, etc.

To know more about growth rate here

https://brainly.com/question/14122627

#SPJ2

PLEASE HELP ASAP I REALLY NEED HELP PLEASEEE 02.08 What's Your Big Idea?
You have previously written the introduction to your compare and contrast article. Now you will write the two body paragraphs to continue your compare and contrast article.
Note: One body paragraph is to compare similar features of both of your two chosen articles, and the other body paragraph is to contrast different features of both of your chosen articles. The body paragraphs are not summaries of each article.

View the grading rubric as you complete your assignment. This is your guide to a super submission.

You have previously written the introduction to your compare and contrast article. Now you will write the two body paragraphs to continue your compare and contrast article.
Be sure to use the information you previously wrote in your Compare and Contrast Organizer.
In your body paragraphs, remember to include:
Topic sentence for each body paragraph that relates to thesis
Support for your topic sentence with facts from your research
Signal phrases to identify ideas that are not your own
One direct quote, correctly punctuated
Transition phrases at the beginning of each paragraph
Technical language to show your understanding of the topic
Body paragraphs that compare and contrast two helpers
Write three or more complete sentences in each paragraph
Write in formal style using the third person point of view.
Use correct grammar, punctuation and spelling.
Add your introduction to the body.
Save your work to your computer or drive.
Submit your work in 02.08 What's Your Big Idea?
If needed, review your chosen articles.

Read the articles.
Article 1-Minutes That Matter
Article 2-Defeating Dragons
Article 3-Food That Fuels

Answers

Answer:

To start off, let's discuss how these two heroes are similar. First, these heroes we are talking about are teens. Yes, you heard it here folks these people are in between the age of 14 - 18. They also both help others. For example, Brittany Bergquist and her brother Robbie take time out of their day to provide more talk time for soldiers. On the other hand, team made up of girls and boys help people that need medical assistance 24 hours a day. But most importantly they both enjoy, love, and are amazed by what they are doing.

thats paragraph one youre going to do paragraph 2 yourself because im still working on paragraph 2

Explanation:

The distinguishable between Food that fuels and minutes that matter is one's to benefit soldiers to help communicate with his family while they fight for our country.

On the other hand is to help keep their families warm during the winter for the parents working to make ends meet.

First similarity of these two are that they both used recycled items to solve their problem within their families and meet the needs in their community.

But don't forget about the smart kids that came up with the idea to recycle their belongings to solve the problem and let nothing go to waste.

Another difference is that the solution to the obstacle affected the families and households different because the circumstances were totally opposite and now a family warm while a solider can call home to his family but all with smiles on their faces.

What is Food?

Food is a substance consisting essentially of protein, carbohydrate, fat, and other nutrients used in the body of an organism to sustain growth and vital processes and to furnish energy.

The absorption and utilization of food by the body is fundamental to nutrition and is facilitated by digestion.

Plants, which convert solar energy to food by photosynthesis, are the primary food source.

Animals that feed on plants often serve as sources of food for other animals.

What is Fuel?

Fuel is a substance that is burned to provide nuclear energy, heat or power.

Materials like coal, wood, oil, or gas can provide heat when burned. Methanol, Gasoline, Diesel, Propane, Natural gas, Hydrogen are types of fuel. Nuclear energy is produced by burning plutonium.

From fuel efficiency or fuel economy, we can measure how long any vehicle could travel, which is the opposite of fuel consumption.

Fuel consumption is the amount of fuel vehicle uses to travel a particular distance.

Fuel efficiency can be measured in kilometers per liter. The efficiency with which the fuel does a conversion of energy is known as fuel efficiency.

To learn more about Food are here

https://brainly.com/question/14836263

#SPJ2

.

Explain why quaternary consumers occupy the top position in the pyramid of energy.

Answers

Answer:

quaternary consumers, they occupy the top position in a pyramid because nothing preys upon them in return. also a prey of one species could be another predator of species.

Explanation:

Answer:

They occupy the top position in a pyramid because nothing preys upon them in return. Also, a prey of one species could be another predator of species.

Explanation:


Why are enzymes so important to all living things? Give a real-life example to back up your answer.

Answers

Explanation: Enzymes help all life forms by allowing reactions to occur at a necessary rate of time. Like a maps allows you to turn at the right time and tells you when to turn around at the right time.

what is photosynthesis

Answers

Answer:

It is the process where the plants use sunlight to gain their food.

Explanation:

Photosynthesis in plants generally involves the green pigment chlorophyll and generates oxygen as a byproduct.

Hope this helps!

Answer:

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar

Explanation:

mark me as brainiest :D

in humans, how many chromosomes are in each gamete after meiosis?

Answers

15

If a cell has 15 pairs of chromosomes (n = 15), it has 30 chromosomes (2n = 30). At the

end of mitosis, the two daughter cells will be exact copies of the original cell. Each daughter

cell will have 30 chromosomes. At the end of meiosis II, each cell (i.e.,

What is the function of active transport in moving small molecules and ions across the cell membranes? Give an example.

Answers

Active transport enables cells to move some materials against a concentration gradient. For example, cell can concentrate substances such as sodium and potassium ions in particular locations.

Hope this helps

when does an electron emit energy in the form of a photon?

Answers

Answer:

When the electron changes levels, it decreases energy and the atom emits photons. The photon is emitted with the electron moving from a higher energy level to a lower energy level. The energy of the photon is the exact energy that is lost by the electron moving to its lower energy level.

Why do you think that some people didn't initially believe that climate change was taking place?
What kinds of reasons might make people reject the idea

Answers

Answer:

becayse

Explanation:

yes becuase rhat grrrrr

Other Questions
which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday