how are stem cells related to the idea that cells are different according to their function?

Answers

Answer 1

Answer:

Stem cells are undifferentiated, or “blank,” cells. This means they're capable of developing into cells that serve numerous functions in different parts of the body. Most cells in the body are differentiated cells. These cells can only serve a specific purpose in a particular organ.

Answer 2

Stem cells are different from other cells in the body in three ways: They can divide and renew themselves over a long time. They are unspecialized, so they cannot do specific functions in the body. They have the potential to become specialized cells, such as muscle cells, blood cells, and brain cells.


Related Questions

inhaling a foreign substance into the upper respiratory tract can cause pneumonia. true or false?

Answers

Answer:

True

Explanation:

the place in the retina where the optic nerve exits to the brain is called the

Answers

Answer:

optic disk

Explanation:

The optic disk is the part of the retina where the optic nerve leaves the eye and heads to the brain.

during or after exercise, it is normal for a student-athlete to comment that his/her heart feels like it is beating out of their chest. true or false

Answers

This is the totally normal, bounding-heart feeling we get when upset, or during or after exercise. The heart is beating correctly, just fast.

A student-athlete will normally comment that his/her heart feels like beating out of their chest as a natural reaction of the cardiovascular system during exercise. TRUE.

Jumping heartbeat is what you experience when you engage in strenuous or intensive exercise. This is due to the following changes that occur during exercise:

You gasp for air as your body need more oxygenYour pulse/heart rate increases

These are natural and important reactions of the cardiovascular system during intense exercise.

The blood circulates oxygen. During exercise, you expend more oxygen. So, your cardiovascular system work rate increases during exercise.

Thus, a student-athlete will normally comment that his/her heart feels like beating out of their chest as a natural reaction of the cardiovascular system during exercise. TRUE.

Learn more here:

https://brainly.com/question/7104893

Name an unreleased kanye song

Answers

Answer:

Life of the party

Explanation:

Answer:

KanYe West Demo Beat Tape [c. Sept. 97']

tuberculosis can be transferred by airborne transmission. true or false?

Answers

Answer:true

Explanation:airborne

Tuberculosis being transferred by airborne transmission is true. Tuberculosis is a contagious disease caused by a bacteria called Mycobacterium tuberculosis. This bacteria attacks the lungs and if left untreated causes death.

This disease affects the lungs and different airways such as mouth and nose

in which oxygen can pass through. The lung being the main organ for

respiration spreads the bacteria to the mouth and nose and are contained in

the droplets. which is why when an individual sneezes or coughs it becomes

airborne and transferred through inhalation.

Read more on https://brainly.com/question/18791374

drugs such as alcohol and opiates that calm neural activity and slow body functions are called

Answers

Answer:

Depressants are drugs that reduce neural activity and slow body functions. They include 1. Alcohol 2. Barbiturates 3.

Explanation:

Hope this helps :)

typical american diets tend to promote a chronic state of inflammation, which likely contributes to risk for many chronic diseases. classify the following dietary components as pro-inflammatory or anti-inflammatory.

Answers

Answer:

classify the following dietary components as pro-inflammatory or anti-inflammatory.

Explanation:

which monosaccharide rarely occurs freely in nature?

Answers

Galactose, just like glucose and fructose, is C6H12O6. Galactose is rarely found free. Bonded to glucose, it forms lactose or milk sugar. Once ingested, both fructose and galactose are converted into glucose for an organism's energy needs.

MAY SOMEONE PLZ HELP ME ILL GIVE BRAINLEST :(((

Answers

i hope this helps! if you need anything else i can help ^^

your patient is not responsive and is not breathing. you can palpate a carotid pulse. which action do you take next?

Answers

Answer:

See below

Explanation:

Check for blocked airway.  Clear blockage if necessary.  Start artificial resuscitation.

hearing occurs, in part, when sound waves reach the "eardrum" or ________.

Answers

the answer is inner ear

Answer:

Hearing occurs, in part, when sound waves reach the "eardrum" or Tympanic membrane

what is the process of hearing?

1) The eardrum or the tympanic membrane moves when sound travels through the ear canal.

2) The eardrum will vibrate in response to the various sounds.

3) These sound waves get to the cochlea in the inner ear through the ossicles.

4) The fluid in the cochlea travels like ocean waves as a result of sound vibrations.

5) Fluid movement causes hair cells to move. Any neurological impulses made by the hair cells are picked up by the auditory nerve. Hair cells on one end of the cochlea transmit low-pitched sound, whereas hair cells on the other end transmit high-pitched sound.

6) The auditory nerve transports impulses to the brain, where they are transformed into audible sounds that may be recognized.

Hence eardrum is also called tympanic membrane and hearing occurs only when sound travels through it.

to learn more about eardrum here:

https://brainly.in/question/13757387

#SPJ2

gluteraldehydes are among the most effective chemical control agents because they __________.

Answers

Answer:

Gluteraldehydes are among the most effective chemical control agents because they: Are relatively safe, yet considered a sterilizing age

Explanation:

the smallest conducting passageways of the lungs are known as

Answers

Answer: bronchioles.

Explanation:

how does physical activity benefit your mental health

Answers

Answer:

It can improve your muscle strength and boost your endurance.

Answer:

physical activity triggers your brain into releasing endorphins (feel good chemicals), this will result in you feeling happier. Physical activity also helps to reduce stress

Choose the answer.
Which prefix means difficult or painful?
a. post-
b. auto-
c. dys-
d. mal-

Answers

Dys. Explanation:Just had a test on this today
The answer is dys-. Post- means after. Auto- means self. Mal- means disease, disorder, defective, or abnormal.

click and drag to indicate whether each of the following foods contains preformed vitamin a or provitamin a carotenoids.

Answers

Answer: eats plenty of food that contain beta-carotene

Explanation:

arjun has a headache; he takes some aspririn, and the headache goes away. arjun is more likely to take aspirin again. this is an example of

Answers

Answer: this is an example of overdosing

Explanation:

He took to much aspirin

tasks that an employee is legally allowed to perform based on his or her training and certification

Answers

Healthcare workers have a legal and ethical responsibility to protect the patients they care for. When these responsibilities are ignored, patients suffer. Additionally, healthcare workers can be held responsible for these behaviors. Ethical behavior or responsibility is doing the right thing for the patient.

Answer:

Healthcare workers have a legal and ethical responsibility to protect the patients they care for. When these responsibilities are ignored, patients suffer. Additionally, healthcare workers can be held responsible for these behaviors. Ethical behavior or responsibility is doing the right thing for the patient.

Explanation:

a drug that inhibits mitosis, such as griseofulvin, would be more effective against

Answers

Correct Answer is Fungi.

By altering the activity of the mitotic spindle microtubule (MT), the antifungal medication griseofulvin prevents mitosis robustly in fungal cells and slightly in mammalian cells. Thus, option C is correct.

What impact of griseofulvin on fungi?

Your skin may become more sensitive to sunlight than usual while taking griseofulvin. Even brief exposure to sunlight can result in skin rashes, irritation, redness, various skin discolourations, or a painful sunburn.

By inhibiting fungal cells from splitting and proliferating, griseofulvin interferes with the process of fungal mitosis, ultimately causing the infection to disappear. Itching, red, peeling, scaly skin, and discoloured nails are just a few of the symptoms that will go away once the infections and fungus are removed.

Therefore, a drug that inhibits mitosis, such as griseofulvin, would be more effective against fungi.

Learn more about griseofulvin here:

https://brainly.com/question/29997246

#SPJ12

which medical specialty has a shortage of physicians

Answers

Answer:

The range of physician shortages projected by 2033 include the following: Primary care -- between 21,400 and 55,200 physicians Nonprimary care specialties – between 33,700 and 86,700 physicians Surgical specialties – between 17,100 and 28,700 physicians

Explanation:

blood vessel that carries blood away from the heart

Answers

Answer :

Arteries

Explanation:

Arteries the red vessels, take nutrients away from your heart. while veins the blue vessels, take oxygen to your heart.

hope it helps! :))

rationing on the level of the total health care system is known as

Answers

Answer:

Macroallocation

Explanation:

Search it up

how is a bulging disc different from a herniated disc?

Answers

A bulging disc differ from a herniated disc as follows:

The intervertebral disc is a gelatinous structure that allows the flexibility of the spine and acts as a shock absorber, each disc is made up of two elements: the nucleus pulposus and a fibrous ring that surrounds it.

Repeated inappropriate pressure or movement can cause the ring to wear out, resulting in an alteration in the nucleus.

A bulging disc occurs when a damaged disc compacts and pushes back into the spinal canal.

That is, the disc loses its shape and moves out of its normal position to the spine due to pressure from the disc nucleus.

On the other hand, a herniated disc would appear when this wear involves the rupture of the annulus and, therefore, the migration of the nucleus, generating compression in the adjacent structures:

The spinal cord, if it is a central hernia.

The nerve root that is found on both sides of the vertebra, if it is radicular.

Unlike a herniated disc condition, in bulging discs there is no tear or rupture on the tough exterior.

Therefore, we can conclude that a bulging disc happens when the disc loses its shape and moves out of its normal position and a herniated disc involves the rupture of the annulus.

Learn more here: https://brainly.com/question/5126255

The rectal temperature of a body discovered under normal temperature conditions
was measured to be 94.6 degrees F. The body was found at 11:00 AM. Use the Glaister
equation to determine the estimated time of death.

Answers

Answer:

Explanation:

the estimated time of death was 8:00pm

in order to palpate an apical pulse when performing a cardiac assessment, where should the nurse place the fingers?

Answers

Answer: Left center of chest

Explanation:

This position roughly corresponds to the lower end of the heart.

learned
une
son.
Common Diseases of Respiratory and Circulatory System
Things that I KNOW
Things that I WANT TO
KNOW
Things that I have
LEARNED
Asthma
Heart Attach
Tuberculosis
Stroke
Influenza
Hypertension
A. Respiratory Diseases
1.
2.
3.
B. Circulatory Diseases
1.
2.
3.​

Answers

Answer:

respatory diseases: 1-lung cancer 2-emphysema 3-cysticfibrosis Circulatory Diseases: 1-cardiac arrest 2- high blood pressure 3-blood clots

Explanation:

These diseases can contain all the items listed above and they are some of the effects if your body is weak then you might have a Chance of getting a type of cancer or getting sick

how long did it take for the measles vaccine to be developed

Answers

nobody going to know that look it up on g o o g l e

by taking a patient into an examination room to discuss their medical history, the medical assistant has protected the patient�s right to __________

Answers

their Right to Privacy

a patient’s spouse and son were recently killed in an automobile accident, and the patient’s position in a large company has been eliminated due to corporate reorganization. the patient states, "i do not think i can handle this." the nurse could safely assume that the patient will soon develop clinical depression. true or false?

Answers

Answer:

True

Explanation:

The patient has recently lost their spouse and son, and I think it safe to assume that the patient has lost their job. Losing people you love could result differently depending on how the patient copes. Grief and the patient now being by themselves while most likely result in depression. The patient might think that there is no point in anything anymore because they have lost the people they love, and their financial support. Something like this will defiantly cause some to have depression.  

imagine you are the nurse manager for nurses on your floor. ever since the new patient management system came online, productivity has been lower than expected. under which circumstance do you decide to develop a training program for the nurses?

Answers

Training program should be developed in other to arrest the issue of productivity as it might be related to the fact that nurses might not know how to correctly input patient's data.

Making upgrades from manual data entry strategy to online data input are meant to allow for proper documentation and increased productivity.

However, training data entry personnels how to user the program is essential in other to yield the expected output or result as they might be new to the system.

Therefore, when nurses do not know the correct data entry process, then a training program ls required.

Learn more : https://brainly.com/question/25174668

Other Questions
help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday which individual from the renaissance was one of the earliest artists to paint rounded, lifelike figures in natural settings? 5 by 8 of the children in the field are girls. There are 45 boys. How many girls are there? which pair of alternatives is highlighted by the life cycle of the cellular slime molds, such as dictyostelium? 6.How does the organization of this text help the reader understand theargument?