HELP IM ABOTH TO FAIL

Given the explicit rule, F(n) = 250 + 130(n-1), what is the 12th term?
Of(12)=-$1180
Of(12)= $1810
O f(12)= $1680
Of(12)=-$1050

Answers

Answer 1

Answer:

f(12) = 1680

Step-by-step explanation:

Substitute n = 12 into f(n) , that is

f(12) = 250 + 130(12 - 1) = 250 + 130(11) = 250 + 1430 = 1680


Related Questions

please help I’ll give you a points :,)

use estimation to check whether 96.26 is a reasonable solution fot the equation m-62.74=159

Answers

Answer:

See below

Step-by-step explanation:

I hope you wrote down the right equation using a minus sign instead of a plus.

Rounding 96.26 off to just 96  and then rounding 62.74 off to 62, you can subtract the two in your head real quick.

96 - 62 = 34

So using this estimation you can see that the answer of 159 is no where near correct.

PLEASE HURRY
One number is two less than a second number. Five times the first is 8 more than 2 times the second. Find the numbers
what is the value of the first and second number?

Answers

Answer:

PLEASE MARK BRAINLIEST

Step-by-step explanation:

a+2= b

5a - 8 =2b

a= b- 2

since(a= b- 2)

5(b-2) -8 = 2b

5b -10 - 8 = 2b

3b -18 =0

3b=18;b=6

since b =6

a= 6-2 ; a= 4

More coins for youuu + follow for brainliest :)​

Answers

Answer:

10 + 78.567 = 88.567

Step-by-step explanation: thank you

You roll a number cube find the probability. P(3 or 4)

Answers

Say the cube has sides numbered 1-6 that means there are 6 possible outcomes. 3 and 4 are only two possible outcomes so the probability of that is 2:6. Simply 1:3 or 33%
Values of cube= 1,2,3,4,5,6 = 6(total)
P(3 or 4) = 2\6 = 1/3 (ans)

A city has 1,242 law enforcement officers in the police department. If the officers are divided equally into 18 groups, how many officers will be in each group

Answers

69 officers will be in each group

Answer C: 69

Step-by-step explanation:

1242 divided by 18 = 69

HELP ASAP PLEASE DUE TOMORROW!!! THANK YOU :)​

Answers

Answer:

-155.15

-223.75

Step-by-step explanation:

Transaction 1 was a deposit of 360. The account had nothing in it before that deposit. After the 360 deposit the balance is 360.

Transaction 2 is -22.50. That means 22.50 was withdrawn (taken out) from the account. The balance after transaction 2 is 360 - 22.50 = 337.50.

Before transaction 3 takes place, the balance is 337.50.

After transaction 3 takes place, the balance is lower. It is now 182.35.

The amount of money taken out in transaction 3 is 337.50 - 182.35 = 155.15. Transaction 3 is -155.15.

The balance after transaction 3 is 182.35. The balance after transaction 4 is -41.40 which is lower than 182.35, so transaction 4 is again withdrawing money from the account.

The amount of transaction 4 is:

182.35 - (-41.40) = 223.75

Transaction 4 is: -223.75

Answer:

-155.15

-223.75

Ms. Janis teaches math to 254 students each day. she grades one paper for each student each day. if Ms. Janis teaches for 25 days this month, how many papers does she grade?

please help me​

Answers

Answer:

6,350

Step-by-step explanation:

254 times 25 is 6,350

Answer:

6350 Papers

Step-by-step explanation:

254 x 2 = 508

508 x 10 = 5080

(This is basically 254 x 20)

254 / 2 = 127

127 x 10 = 1270

(This is basically 254 x 5)

5080 + 1270 = 6350

Find two consecutive even integers such that 4 times the smaller integer is 44 less than 7 times the larger integer

Answers

Answer:

let x be the smaller number.

let x + 2 be the larger number.

4 times the smaller number is 2 more than 3 times the larger number.

in equation form, this becomes:

4x = 3 * (x+2) + 2

simplify this to get:

4x = 3x + 6 + 2 which becomes:

4x = 3x + 8

subtract 3x from both sides of this equation to get:

x = 8

this means that x+2 = 10

the smaller number is 8 and the larger number is 10.

4 times the smaller number is equal to 32.

3 times the larger number + 2 is equal to 32.

requirements of the problem check out ok, so the solution is good.

the smaller number is 8.

the larger number is 10.

Step-by-step explanation:

please mark me as the

A manufacturer has a monthly fixed cost of $40,000 and a product cost of $8 for each unit produced. The products sells for $12/unit.

Answers

Answer:

48,000

Step-by-step explanation:

The cost function by the given data is C(x) = 40,000 + 8x.

We are given that;

Monthly fixed cost = $40,000

The product cost for each unit produced= $8

Now,

The cost function is a function that gives the total cost of producing a certain number of units. The cost function depends on the fixed cost and the variable cost per unit. The fixed cost is the amount of money that the manufacturer has to pay regardless of how many units are produced, such as rent, salaries, utilities, etc. The variable cost per unit is the amount of money that the manufacturer has to pay for each unit produced, such as materials, labor, etc.

In this case, the fixed cost is $40,000 and the variable cost per unit is $8. To find the cost function, we need to add the fixed cost and the product of the variable cost per unit and the number of units.

We can use x to represent the number of units and C(x) to represent the cost function.

Then we have:

C(x) = fixed cost + (variable cost per unit)(number of units)

C(x) = 40,000 + (8)(x)

Therefore, by algebra the answer will be C(x) = 40,000 + 8x.

More about the Algebra link is given below.

brainly.com/question/953809

#SPJ2

At Barton High School, 45 students are taking Japanese and this number is increasing
by 3 students per year. 108 students are taking German, but this is decreasing by 4

Answers

Answer:

what's the question to this given data?

Juan graphed a line with a slope of -23
How does Juan count the slope from any point on the graph?

a. From any point on the graph, he counts down 2 then right 3 to end up on the line again.

b. From any point on the graph, he counts up 2 then right 3 to end up on the line again

c. From any point on the graph, he counts down 2 then left 3 to end up on the line again.

d. I don't know.

Answers

Answer:

a. From any point on the graph, he counts down 2 then right 3 to end up on the line again.

Step-by-step explanation:

The slope is -2/3.

-2/3 = 2/-3

slope = rise/run

rise/run = -2/3

Count down 2 and right 3.

rise/run = 2/-3

Count up 2 and left 3

Answer: a. From any point on the graph, he counts down 2 then right 3 to end up on the line again.

ill give brainlyist Write the equation of the line that passes through the points (-1,3)(−1,3) and (-6,-7)(−6,−7). Put your answer in fully reduced point-slope form, unless it is a vertical or horizontal line.

Answers

Answer:

negative slope intercept

Step-by-step explanation:

Please help me fast I am confused!!!

Answers

Answer:

The second choice.

Step-by-step explanation:

A linear functions graph is a straight line.

A box of chocolates contains bars of milk chocolate and dark chocolate. The weight of each bar of milk chocolate and dark chocolate is 150 ounces and 100 ounces respectively. If the number of bars of dark chocolate is 12 more than the number of bars of milk chocolate, and the total weight of the chocolates in the box is 2950 ounces, find the number of bars of milk and dark chocolate.

Answers

Answer:

7 milk chocolate

19 dark chocolate

Step-by-step explanation:

It is 2950 ounces in total, and dark chocolate is 100 ounces per bar and milk chocolate is 150 ounces per bar. There are 12 more dark chocolate bars so I multiplied 12 by 100 and that was 1,200. Then I took 2,950-1200=1,750. From there I subtracted 150 and 100 till I got to 0.

Number of bars of milk chocolate: 17

Number of bars of dark chocolate: 29

Let's use algebraic equations to solve the problem. Let's denote the number of bars of milk chocolate as "x" and the number of bars of dark chocolate as "y."

1. Weight equation: The total weight of the chocolates in the box is 2950 ounces.

We can express this as an equation:

150x + 100y = 2950  

2. Quantity equation: The number of bars of dark chocolate is 12 more than the number of bars of milk chocolate.

We can express this relationship as:

y = x + 12

Now, we have a system of two equations with two variables:

Equation 1 : 150x + 100y = 2950

Equation 2 : y = x + 12

To find the values of x and y, we can use substitution or elimination. Let's use substitution in this case.

From Equation 2, we can substitute the value of "y" in terms of "x" into Equation 1:

150x + 100(x + 12) = 2950

Now, we can solve for "x":

250x + 1200 = 2950

250x = 1750

x = 7

Now that we have the value of "x," we can find the value of "y" using Equation 2:

y = x + 12

y = 7 + 12

y = 19

So, the number of bars of milk chocolate (x) is 7, and the number of bars of dark chocolate (y) is 19.

To know more about Algebraic Equations here

https://brainly.com/question/29964992

#SPJ2

Please help me due soon

Answers

he bought 20 pounds of pet food

The circle graph shows the results of a survey. Of those surveyed, 80 said yes. About how many people were surveyed?

Answers

Answer:

134 people

Step-by-step explanation:

80 / .6 = 133.333

Answer:

134 people

Step-by-step explanation:

we can use cross multiplication to solve this problem:

we know that 60% is 80 people and 40% is x people (we put x because we don't know the exact number of how many people yet)

now we set it up:

[tex]\frac{80}{60}[/tex] = [tex]\frac{x}{40}[/tex]

= 60x = 3200

= x = 53.33333

now we add the two numbers of people up:

53.33333 + 80 = 133.3333

since it is a decimal, it would be safer to assume that there are 134 people

Can y'all help with this?

Answers

Answer:

Step-by-step explanation:

rate = a

a = -16-(-11)/9-6

a= -5/3

7.Austin has no money so he borrowed $28 over eight days from Kayla. How much did Austin borrow from Kayla each day? Show your work

8.The temperature dropped 6 degrees for 9 hours. What was the total change in temperature.

14.The product of two integers is -24 and the sum of the two integers is -5. What are the two integers?

Answers

#7. let x = the amount of money he borrows each day. so, the equation would be 8x (because it’s over 8 days, so 8 times x) = 28

so equation: 8x=28
then solve for x, which is 3.5 so $3.50

8. Melody subscribes to a coffee service. For $10 a month, Melody is able to purchase a cup of coffee for the
discounted price of $2 for each cup. This situation can be modeled by the function f(x) = 2x+10, where x
represents the number of cups of coffee Melody can purchase. This membership caps the number of cups of
coffee that can be purchased each month at 6.
(D)
Which answer choices best describe the domain and range of f?
Choose TWO correct answers from the 5 choices.
ооооо
The range of the function is 102y 2:22.
The domain of the function is 02 x 6. (S-V)E- = (-)5 noitsupe er zelam v to oulev derW.A
The domain of the function is (10, 12, 14, 16, 18, 20, 22).
MO
The range of the function is {10, 12, 14, 16, 18, 20, 22}
a e
А A
v brex noswiad girlanousion seri seworla data

Answers

Answer:

Domain: 0 <= x <= 6

Range: 10 <= x <= 22

Step-by-step explanation:

There is no minimum to the number of cups she can purchase, thus x > 0 or x >= 1. The maximum amount she can purchase is x = 6 or x <= 6, thus 0 <= x <= 6. Plugging these two values into the function we get a range of 10 <= x <= 22.

Help please this is for geometry. its easy.

Answers

Answer:

Step-by-step explanation:

ccadcdddddddddddddddddddddddd

round 0.004198223 to 3 significant figures

Answers

Answer:

0.00420

Step-by-step explanation:

to take 3 significant figures, u need to take the first 3 numbers(ignore those 0 at the beginning

Answer:

0.00420

Step-by-step explanation:

The expression 4(3x + 7x2 – 7x + 7) – (7x2 + 7x – 7) equals
23 +
x ² +
+

Answers

Answer:

wonk

Step-by-step explanation:

Drag and drop the correct number to complete the equation.

Answers

Answer:

3

Step-by-step explanation:

PLEASE HELP PLEASE PLEASE HELP PLEASE​

Answers

Answer:

2

Step-by-step explanation:

it dot number 2 to click

Answer:

0 ≤ months ≤ 12

Step-by-step explanation:

Domain is the x-values and axis, so it is 0 to 12.

Hopefully this helps!

Brainliest please?

5x+3y=-16
-10x-3y=11
Find the solution

Answers

Answer: x = 3.2 + 0.6y

Step-by-step explanation: Simplifying

5x + -3y = 16

Solving

5x + -3y = 16

Solving for variable 'x'.

Move all terms containing x to the left, all other terms to the right.

Add '3y' to each side of the equation.

5x + -3y + 3y = 16 + 3y

Combine like terms: -3y + 3y = 0

5x + 0 = 16 + 3y

5x = 16 + 3y

Divide each side by '5'.

x = 3.2 + 0.6y

Simplifying

x = 3.2 + 0.6y

Should I add anything for my transformation project or is this bad image I’m so not sure if it’s good or I should add or try again…….

Answers

nop its really good

no need to do any changes

Juan earns 52 dollars per week
working part-time at a book store.
He makes one dollar more for each
book that he sells. The amount, A
(in dollars), that Juan
earns in a week if he sells b books
is given by the following.

A=52 + b

How much does Juan earn in a
week if he sells 37 books?

Answers

Answer:

the answer is 89

Step-by-step explanation:

52 plus 37 = 89

Answer:

89 books

Step-by-step explanation:

he sells 37 books so we do 52+37 and get 89

2 less than the quotient of 56 and 7

Answers

Answer:

54 and 5

Step-by-step explanation:

56-2 is 54

7-5 is 2

have a good day my little friend learning his 1st addition

A city planner wants to build a road parallel to 2nd Ave . What is the slope of the new road?

Answers

Answer:

0

Step-by-step explanation:

By inspection or finding points, we see that 2nd ave is perfectly flat, or in other words, has slope of 0.

If line 1 is parallel to line 2, it means their slopes are the same.

So, the new road parallel to 2nd ave has a slope of [tex]\boxed{0}[/tex].

plz help no one will help me

Answers

Answer:

left

domain -7 =<x< 10

range -8 to 5

right

domain -7<x<=9

range -7<Y<=5

Other Questions
Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work!