Given information about the economy of Pakistan, calculate Pakistan's GDP. Note that the currency of Pakistan is the rupee. Assume that the values are all current and no conversions need to be made. The government spends 3.40 trillion rupees. Individuals consume 9.60 trillion rupees. Individuals save 5.01 trillion rupees. Businesses invest 1.40 trillion rupees. Foreigners invest 0.70 trillion rupees. Pakistan imports 2.33 trillion rupees. Pakistan exports 1.23 trillion rupees. Pakistan's GDP is _________ trillion rupees.

Answers

Answer 1

The Gross domestic product of Pakistan is 13.30 trillion rupees

The gross domestic product (GDP) of country is the total value of all the goods and services a country produces in a year.

GDP can be calculated using the expenditure approach. The expenditure approach entails adding the total amount spent by consumers, government and businesses in the production process.

GDP using the expenditure approach = amount spent by consumers + business investment + Government spending + (export - import)

9.60 + 3.40 + 1.40 + (1.23 - 2.33) =

9.60 + 3.40 + 1.40 -1.10 = 13.30 trillion rupees

A similar question was answered here: https://brainly.com/question/15177447?referrer=searchResults


Related Questions

when the money market is drawn with the value of money on the vertical axis, if the price level is above the equilibrium level, there is an

Answers

Answer:

There will be an increase in the price level.

Explanation:

Got it from study.com

anderson oil often assigns employees to travel and work abroad on international projects. however, anderson oil leaders understand that travel is more difficult for employees with disabilities, so employees who require special accommodations for their jobs do not receive international travel assignments. is anderson oil engaging in workplace discrimination?

Answers

Considering the situation described above in the question, Anderson oil is engaging in workplace discrimination.

This is because this situation is often described as an example of disparate treatment, and it is considered intentional or unlawful discrimination.

Given that Anderson Oil deliberately treats employees with disabilities differently, it is considered disparate treatment, a form of discrimination.

Hence, in this case, it is concluded that the correct answer is Yes; Anderson Oil is engaging in work placement discrimination using a disparate treatment strategy.

Learn more here: https://brainly.com/question/13755136

do you want high or low interest rate on loan/credit explain

Answers

Answer:

People with higher credit scores should qualify for loans at better rates.

Explanation:

If you have a credit score of 750, 36% interest rate would be a considered a higher interest rate -- but if your score is 580, this would likely be a very good interest rate based on your credit history.

Hope this helps! Have a great day my loves <3

by what date must taxes be filed in the united states?

Answers

Answer:

april 15

Explanation:

its a direct question the isnt an explanation

Who made this website?

Answers

Answer:

Michal Borkowski, Tomasz Kraus, Lukasz Haluch

Explanation:

how to get all one hundreds on report card

Answers

Answer:

well thats easy all you have to do is get a good grade on every single assignment in every class

Explanation:

which is very hard

Answer:

To do your work and stop asking how to get around it on Brainly. Please don't cheat, your teacher can see past that, especially when you copy verbatium like I bet you do.

Explanation:

Which of the following is an example of an economic good?
a. Sunlight
b.Air Petrol
c.None of the above​

Answers

Answer:

A) sunlight

Explanation:

solar energy... reusable and efficient

please mark as brainliest

Answer:

Sunlight

Explanation:

piaget’s concrete operational stage is characterized by the active, appropriate use of __________.

Answers

Piaget’s concrete operational stage is characterized by the active, appropriate use of: logic.

Jean Piaget was a developmental biologist and psychologist who was born on the 9th of August, 1896 in Neuchâtel, Switzerland.

Piaget worked extensively on cognitive development in infants and teenagers based on the following:

Judgement.Knowledge.Thoughts.

Jean Piaget's stages of cognitive development in an ascending order includes;

I. Sensorimotor stage.

II. Preoperational stage.

III. Concrete operational stage.

IV. Formal operational stage.

The concrete operational stage is typically described as age 7 through age 11, at which the child thinks logically.

In conclusion, the active, appropriate use of logic is a feature of John Piaget’s concrete operational stage.

Read more: https://www

brainly.com/question/20355893

Amortization ______. (Check all that apply.) Multiple select question. is calculated using the straight-line method spreads the cost of intangible assets to expense over their useful lives is used for expensing the cost of land over its useful life is in accordance with the matching principle

Answers

Statement that describes Amortization as regards this question are;

spreads the cost of intangible assets to expense over their useful lives.

is calculated using the straight-line method.

Amortization can be regarded as a process involving writing down the value of either a loan or an intangible asset.

Amortization schedules  helps in presentation of loan repayment by lenders.

Therefore, we can calculate Amortization by utilization of straight-line method.

Learn more at,:

https://brainly.com/question/15357884?referrer=searchResults

Answer:

- spreads the cost of intangible assets to expense over their useful lives

- is in accordance with the expense recognition (matching) principle

- is calculated using the straight-line method

Explanation:

which region gained the most from the exchanges of ideas and technologies facilitated by the mongol empire?

Answers

Answer:

europe

Explanation:

DeShawn formed a hiring committee for his advertising company. Six employees (including two managers) met to discuss applicants and select the finalists for a copywriter position in the public relations department. Although the head of public relations would have the final nod on the candidate that would ultimately be hired, the evaluative work of the committee was very important because they sent forward a candidate they believed would be a good work colleague, and their input facilitated the ultimate decision. In setting up this type of hiring process, the head of public relations was utilizing a(n) __________ style of leadership.\

Answers

The head of public relations utilized a leadership style called democratic or participative style.

The democratic leadership encourages the active participation of the members of the hiring committee, who select the finalists for the position.

Decision-making is shared between the hiring committee and the head of the public relations department.  The hiring committee carries out candidates evaluations to guide the final decision by the head of the department.

As the direct opposite of the participative or democratic leadership style, the autocratic style does not encourage the committee to decide the final candidate for the position.

Thus, a democratic leadership style is participative and encourages input from members of the selection group.

Learn more: https://brainly.com/question/23447988

Which statements best explains how globalization offers an advantage to businesses

Answers

Answer:

Hello here's the answer!

Explanation:

A

C

D

E

your welcome! Brainliest if you liked the answer!

fob destination means that goods are owned by the buyer as soon as ______.

Answers

FOB Destination describe goods whose risk will be catered by Seller until being delivered to the buyer.

FOB Destination is an acronym for "Freight on Board" Destination

The FOB Destination is a marine term used to describes that legal title of goods belongs to the Seller until they are delivered to buyer.

In other word, its means that seller of a product owns the risk of loss on a goods until its is delivered to the buyer.

In conclusion, the term states that the goods are owned by the buyer as soon as it is not delivered to the buyer.

Read more on FOB Destination here

brainly.com/question/15102930

All of the following are advantages to the franchisor except a. fast and selective distribution of products. b. a freeing up of capital for expansion of goods and services. c. no involvement in national advertising campaigns. d. gains from the franchisee's high motivation. e. assurance of how the outlets will be maintained and operated.

Answers

The statement that does not explains advantages to the franchisor is B:no involvement in national advertising campaigns.

The franchisor can be regarded as the original or existing business which give out its name out on a price for other business to have the right to use the name and idea.

The franchisor then is responsible for continual guidance as well as  support as regards general business strategies.

One of the advantage of a franchisor is that they provide high motivation to the business under them.

Therefore, franchisor give out their name fir a price.

Learn more at:

https://brainly.com/question/14982702?referrer=searchResults

unlimited liability as it relates to sole proprietorships is the risk of loss of assets beyond the assets of the business.

Answers

The risk of loss of assets beyond the assets of the business is referred to as unlimited liability. It is one of the characteristics of a sole proprietorship.

A sole proprietorship is a form of business organisation is which only person owns the business.  

Characteristics of a sole proprietorship

it is owned by one personthe business has unlimited liability. It means that the owner of the business is liable to the liabilities her business.  the business usually lacks continuity. this type of business usually ceases to exist when the owner dies.

Advantages of sole proprietorship

It is easy to establish.  The business owner has complete control over the business.  

Disadvantages of sole proprietorship

The lifespan of the business is often limited to the lifespan of its owner. The owner has an unlimited liability.

A similar question was answered here: https://brainly.com/question/21297889

Final Review
Which of the following is not a type of discrimination?
A. Racial
B. Gender
C. Religious
D. Supervisor/Employee
Submit

Answers

Answer:

D: Supervisor/Employee

The correct option is D. Supervisor/Employee is not a type of discrimination.

Employers are not permitted to discriminate against job applicants on the basis of their race, color, religion, or sex. Unfair treatment or harassment can take many different forms, some of which include spreading false information about you. being unjust to you.

What is constructive discrimination?

Unfair treatment can occur when a regulation or practice mistakenly singles out a certain group of individuals. "Constructive" or "adverse effect" discrimination is the term used to describe this kind of inadvertent bias. As an illustration, one business mandates that all male employees have clean-shaven faces.

As it relates to policies, programs, employment, and services offered by any organization, systemic discrimination refers to the practices, routines, and organizational culture that, frequently without intention, result in less favorable outcomes for minority groups than for the majority of the population.

You must take action if your boss' actions and crude remarks pose a threat. Speak with the human resources division of the business. If nothing changes after that, you might even think about complaining about your supervisor and the business to the labor department in your state.

Learn more about Discrimination here:

https://brainly.com/question/14896067

#SPJ5

Did your marketing efforts create more accurate expectations about the product?

Answers

Answer:

Yes...But is a written statement of your company's marketing goals and plan for achieving them..This section of the marketing plan describes the features of the product and its benefits for people in your target market.

This is where you discuss the needs, desires, and fears of your target market and consider how you can use these emotions to make your product's benefits most attractive..

Explanation:

Hope it helps you..

But If you don't get my answer, i-its fine..(;ŏ﹏ŏ)

B-but... Y-your welcome in advance..

(;ŏ﹏ŏ)(ㆁωㆁ)

what is the opportunity cost of investing in capital?

Answers

Answer:

The opportunity cost of investing in capital is the loss of consumption that results from redirecting resources toward investment. Overinvestment in capital is possible because of diminishing marginal returns: As the stock of capital rises, the extra output produced from an additional unit of capital falls.

please give brainliest

Identify and explain two ways in which managers could use information obtained in the income statement?

Answers

Answer:

An income statement is one of the three major financial statements that reports a company's financial performance over a specific accounting period.

Explanation:

please help me asap!

Answers

I believe that a company does not pay for publicity.

The inflation rate measures the A. percentage change in the price level from one year to the next year. B. percentage change in the quantity of goods and services consumed by urban consumers. C. cost of the CPI market basket at base period prices divided by the cost of the CPI market basket at current period prices. D. cost of the CPI market basket at current period prices divided by the cost of the CPI market basket at base period prices. E. average price of the goods and services consumed by urban consumers.

Answers

Answer:

Its D

Explanation:

hinguys im back!!!
folloe nyo ko pingay ko points ko sa inyo
dont forget folloe​

Answers

Answer:

hii have a great day ahead tq for the points

why is the McDonald ice cream machine always broken?

Answers

Answer:

its broken again XD

Explanation:

But as the answer to this question

*DEEP DRAMATIC SIGH*

We may never know my dude hang in there!!!!

why does a surplus exist under a binding price floor?

Answers

Answer:

it makes the price so low that the quantity demanded exceeds the quantity supplied on the legal market.

Which of the following accurately defines tolerance in the context of measurement?

A. Ability to convert measurements based on the situation

B. Permissible deviation from a specified measurement

C. Process of adjusting measurement devices

D. System of ranking the precision of measurements

Answers

Answer:

B:Permissible deviation from a specified measurement

Explanation:

Permissible deviation from a specified measurement accurately defines tolerance in the context of measurement. Thus, option B is the correct option.

What is tolerance?

Tolerance is used to describe the provision of an appropriate range of admission from ideas, deeds, or behaviors that someone considers to be morally repugnant but still “tolerated,” because those who should not be outlawed or restricted are those who should be tolerated.

The word “tolerance” throughout the context of measuring refers to the spread seen between the highest and lowest proportions with permitted mistakes. Tolerance is another name for a legally permissible range of flaws, such as quality requirements.

Tolerance in the setting of assessment is defined as that of the allowed variance of a given measurement. Therefore, option B is the correct option.

Learn more about Tolerance, here:

https://brainly.com/question/28199476

#SPJ2

which of these starbucks® coffees was the very first blend we released

Answers

A blend of fine Latin American beans roasted to a glistening, dark chestnut color. Loaded with flavor, balancing tastes of toffee and cocoa, just a touch of sweetness from the roast.

According to Starbucks, the starbucks® coffee that was the very first blend released is " a mix of excellent Latin American beans seared to a glistening, murky chestnut color."

These delicious Latin American beans are prepared with a combination flavor of toffee and cocoa.

Starbucks first prepared this variety in 1971 when the company commenced production in Seattle.

Starbucks is one of the most popular coffee producers in present-day America.

Hence, in this case, it is concluded that the starbucks® coffee that was the very first blend released is " a mix of delicious Latin American beans seared to a glistening, murky chestnut color."

Learn more here: https://brainly.com/question/20533939

why make an app an then only allow two questions

Answers

Answer:i dont know

Explanation:

o d
Of the following, which is NOT in the socio-economic category of managed trade?
a. Embargoes
O b. Countertrade
.
O
O O O
c. Ethics and safety
5.
O
O d. Export cartels
7.
O
O e. The infant industry argument
8.
o
9.
a
10.
o
11.
о
12.
O
13.
оо
14.

Answers

Answer:

D.

Explanation:

Explain the technique of making bamboo based handicrafts with an example.​

Answers

Answer:

Bamboo can be processed into thin strips or sheet materials for bamboo plaiting , commonly known as bamboo strips. The processing procedures of bamboo strips include selecting materials , sawing bamboo, pruning, scraping, dividing, splitting, setting the width, thinning and chamfering.

Explanation:

Example: •Bamboo furniture

•Bamboo toys

•Bamboo wind chimes

•Bamboo lamps and lanterns

•Bamboo placements and coasters

The technique bamboos are processed into thin strips or sheet materials for bamboo plaiting, known as bamboo strips and the processing procedures of bamboo strips include selecting materials, sawing bamboo, pruning, scraping, dividing, splitting, setting the width, thinning and chamfering. For example, bamboo furniture.

What is the process of making bamboo handicrafts?

The process of making bamboo handicrafts is given below. First, the bamboo is completely dried before use. The bamboo is segregated in the beginning according to the products that are going to be made. They are cut to the required sizes with the help of a bamboo sawing machine. The cut bamboo sticks are arranged for the products that have to be made.

The products are always made depending on the client’s orders. For example, to make a stool, bamboo is cut respectively into four sets to make the legs and eight sets of smaller lengths to connect the legs horizontally to get a firm hold of the four legs of the stool. A stool is something similar to that a chair but doesn’t hold a backrest.

A stool is a seat for a single person without any backrest.

Learn more about bamboo, here:

https://brainly.com/question/22167412

#SPJ2

strayer partnered with top employers, business leaders, and recruiters to identify ________ that are critical to performing your best—not just in one field, but across all industries.

Answers

In the business environment, partnering with top employers, business leaders, and recruiters to identify skills that are critical to performing your best, across all industries is a relevant strategic advantage.

Through the knowledge and experience of great leaders and recruiters, a new organization is able to identify the skills needed for its employees to achieve the best performance.

Some of these skills might be:

Communication skills.

Good interpersonal relationship.

Creativity.

Proactivity.

The employee's skills will be essential for the formation of an organizational culture, which should be focused on cooperation, ethics, respect and employee appreciation, in order to achieve greater motivation and productivity.

Learn more here:

https://brainly.com/question/13996722

Other Questions
which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday