1. Write a quadratic equation for the parabola that passes through the
point (2, -3) with roots (-6, 0) and (4,0).

Answers

Answer 1

The quadratic equation with the given conditions is:

[tex]f(x) = \frac{3}{16}(x^2 + 2x - 24)[/tex]

The standard form of a quadratic equation with roots [tex](x_1,0)[/tex] and [tex](x_2,0)[/tex] is given by:

[tex]f(x) = a(x - x_1)(x - x_2)[/tex]

In which a is the leading coefficient.

In this problem, the roots are [tex]x_1 = -6, x_2 = 4[/tex], thus:

[tex]f(x) = a(x - (-6))(x - 4)[/tex]

[tex]f(x) = a(x + 6)(x - 4)[/tex]

[tex]f(x) = a(x^2 + 2x - 24)[/tex]

It passes through point (2,-3), which means that when [tex]x = 2, f(x) = -3[/tex], and this is used to find a.

[tex]a(2^2 + (2)(2) - 24) = -3[/tex]

[tex]-16a = -3[/tex]

[tex]a = \frac{3}{16}[/tex]

Thus, the equation is:

[tex]f(x) = \frac{3}{16}(x^2 + 2x - 24)[/tex]

A similar problem is given at https://brainly.com/question/17987697


Related Questions

wins some money on the lottery. She uses 1/3 of her lottery win to buy a house
and she gives 1/8 of her lottery win to charity. Molly then shares the remainder of her
lottery win equally among her four children. Work out the fraction of Molly's lottery
win that each of her four children receives.

Answers

Answer:11/96

Step-by-step explanation:

1-(1/3)=2/3=14/24

(2/3)-(1/8)=(14/24)-(3/24)=11/24

11/24 divided into 4 again is 11/96

A certain substance in an experiment was being stored at −1.7°F. It was then placed on a table where the temperature was raised by 3.1F
What was the new temperature of the substance?
the answers are
-4.8F
-1.4F
1.4F
4.8F

Answers

1.4F. When you add 3.1 to -1.7 you get 14F

Answer:

The answer is 1.4.

Step-by-step explanation:

The school colors at Mission Middle School are green and white. Kendra volunteered to make cupcakes
for the school bake sale. To make the right shade of green frosting, she uses 7 drops of blue food
coloring for every 3 drops of yellow food coloring.

Answers

64 will be your answer because the amount of blue each time time used for each cupcake will be multiplied into 3 which will be 3

the sum of two numbers is 6 and the sum of their squares is 28. Find the exact values of these numbers

Answers

Answer:

The highest value I could get, without going over, is 5+1=6 and 25+1=26

Step-by-step explanation:

Please help with this question

Answers

D
That’s the answer
624

y=-2/3x + 7 what is the slope?

Answers

Answer:

Lucky for you i'm good at algebra:)

Step-by-step explanation:

Slope:  -2/3

Y-intercepts: (0,7)

Answer:

 Slope = -1.333/2.000 = -0.667

 x-intercept = 21/2 = 10.50000

 y-intercept = 21/3 = 7

Step-by-step explanation:

Rearrange:

Rearrange the equation by subtracting what is to the right of the equal sign from both sides of the equation :

                    y-(-2/3*x+7)=0

Step 1:

Simplify    2/3

Equation at the end of step 1:

y -  ((0 -(2/3• x)) +  7)  = 0

Step 2: Rewriting the whole as an Equivalent Fraction

Rewrite the whole as a fraction using  3  as the denominator :

7 = 7/1  =  7 · 3 /3

Equivalent fraction : The fraction thus generated looks different but has the same value as the whole

Common denominator : The equivalent fraction and the other fraction involved in the calculation share the same denominator

Adding fractions that have a common denominator :

Adding up the two equivalent fractions

Add the two equivalent fractions which now have a common denominator

Combine the numerators together, put the sum or difference over the common denominator then reduce to lowest terms if possible:

-2x+7·3/3 = 21-2x/3

Equation at the end of step 2:

y-(21-2x)/3=0

Step 3:

Rewriting the whole as an Equivalent Fraction :

Subtracting a fraction from a whole

Rewrite the whole as a fraction using  3  as the denominator :

y=y/1=y·3/3

Adding fractions that have a common denominator :

 Adding up the two equivalent fractions

y • 3 - ((21-2x))     3y + 2x - 21

—————————————————  =  ————————————

        3                  3      

Equation at the end of step

3

:

 3y + 2x - 21

 ————————————  = 0  

      3      

STEP

4

:

When a fraction equals zero :

4.1    When a fraction equals zero ...

Where a fraction equals zero, its numerator, the part which is above the fraction line, must equal zero.

Now,to get rid of the denominator, Tiger multiplys both sides of the equation by the denominator.

Here's how:

 3y+2x-21

 ———————— • 3 = 0 • 3

    3    

Now, on the left hand side, the  3  cancels out the denominator, while, on the right hand side, zero times anything is still zero.

The equation now takes the shape :

  3y+2x-21  = 0

Equation of a Straight Line

4.2     Solve   3y+2x-21  = 0

Tiger recognizes that we have here an equation of a straight line. Such an equation is usually written y=mx+b ("y=mx+c" in the UK).

"y=mx+b" is the formula of a straight line drawn on Cartesian coordinate system in which "y" is the vertical axis and "x" the horizontal axis.

In this formula :

y tells us how far up the line goes

x tells us how far along

m is the Slope or Gradient i.e. how steep the line is

b is the Y-intercept i.e. where the line crosses the Y axis

The X and Y intercepts and the Slope are called the line properties. We shall now graph the line  3y+2x-21  = 0 and calculate its properties

Graph of a Straight Line :

 

 

Calculate the Y-Intercept :

Notice that when x = 0 the value of y is 7/1 so this line "cuts" the y axis at y= 7.00000

 y-intercept = 21/3  =  7  

Calculate the X-Intercept :

When y = 0 the value of x is 21/2 Our line therefore "cuts" the x axis at x=10.50000

 x-intercept = 21/2  = 10.50000  

Calculate the Slope :

Slope is defined as the change in y divided by the change in x. We note that for x=0, the value of y is 7.000 and for x=2.000, the value of y is 5.667. So, for a change of 2.000 in x (The change in x is sometimes referred to as "RUN") we get a change of 5.667 - 7.000 = -1.333 in y. (The change in y is sometimes referred to as "RISE" and the Slope is m = RISE / RUN)

   Slope     = -1.333/2.000 = -0.667  

Geometric figure: Straight Line

 Slope = -1.333/2.000 = -0.667

 x-intercept = 21/2 = 10.50000

 y-intercept = 21/3 = 7

solve please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Step-by-step explanation:

it is very easy solve I will tell you if u follow me we should help each other

6. Write the statements "If you take away 6 from 6 time a number, you get
60” in the form of equations:
(a) 6x + 6 = 60
(b) 6x6 = 60
(c) X-6 = 60
(d) none of these

Answers

Answer:

6x-6=60 so if you correctly typed the question its none of them

The Candela brothers own two pizza restaurants, one on Park Street and one on Bridge Road.

The computer output below summarizes the distribution of weekly revenues at each

restaurantâ€"26 weeks for Park Street and 40 weeks for Bridge Avenue.

Answers

The mean, median and mode are measures of central tendency, that is they tend to indicate the location middle of the data

Required values;

(a) The performance for the week for Park Street

Revenue is Q₂ < $7,500 < Q₃The sales for the week is better than 72.91% of all sales

The performance for the week for Bridge Road

Revenue; Q₂ < $7,100 < Q₃The sale for the week is better than 59.87% of all sales

(b) The mean is $3611

The median is $3,600

The standard deviation is $3250

The Interquartile range is $6075

Reason:

The table of values that maybe used to find a solution to the question is given as follows;

[tex]\begin{array}{|l|l|l|}\mathbf{Variable} &\mathbf{Park}&\mathbf{Bridge}\\N&36&40\\Mean&6611&5989\\SE \ Mean&597&299\\StDev&3580&1794\\Minimum&800&1800\\Q_1&3600&5225\\Median&6600&6000\\Q_3&9675&7625\\Maximum&14100&8600\end{array}\right][/tex]

(a) Park Street revenue = $7,500

Bridge Road's revenue = $7,100

The two stores sold close to but below the 75th percentile

Bridge Road revenue;

The z-score is given as follows;

[tex]Z = \dfrac{x - \mu }{\sigma }[/tex]

[tex]Z = \dfrac{7100 - 5,989 }{1794 } \approx 0.6193[/tex]

From the Z-Table, we have;

The percentile= 0.7291

Therefore, the sale for the week for Park Street is better than 72.91% of all the sales

Park Street revenue;

The z-score is given as follows;

[tex]Z = \dfrac{7500 - 6611}{3580} \approx 0.25[/tex]

From the Z-Table, we have;

The percentile = 0.5987

Therefore, the sale for the week is better than 59.87 % of all the sales

(b) Given that the operating cost is $3,000, frim which we have;

The subtracted value is subtracted from the mean and median to find the new value

Profit = The revenue - Cost

New mean = 6611 - 3000 = 3611

The new mean = $3,611

The new median = 6600 - 3000 = 3600

The new median = $3,600

The standard deviation and the interquartile range remain the same, therefore, we have;

The standard deviation = $3,580

The interquartile range = 9675 - 3600 = 6075

The interquartile range = 6075

Learn more here:

https://brainly.com/question/21133077

https://brainly.com/question/23305909

yis inversely proportional tox.Wheny=50,x=4Work outywhenx=8

Answers

Answer:

55555

Step-by-step explanation:

Solve for c. 2a + 3b = c

Please help as soon as possible. Thanks! =D

Answers

Answer:

a = c - 3b/2

Step-by-step explanation:

2a + 3b - 3b = c - 3b

2a = c - 3b

2a/2 = c/2 - 3b/2

therefore your answer is a = c - 3b/2

The value of the digit in the thousands place is_______ times as much as the digit in the hundredths place

Answers

The thousands place is 10 times the value of the hundreds place

Don’t understand I’ll give u a brainly

Answers

It is the second one (B)

The answer is the second one

Which is the better buy?

A 450 g box of cereal for $4.69 or a 600 g box of cereal for $6.49?

Please show ALL of your work.

hint: convert each to a unit rate using "cost / gram", then compare each to see which is cheaper.

Answers

Answer: The first box (the 450 g box for $4.69)

===========================================================

Explanation:

To get the unit cost, we'll divide each price by the weight

The first box has a unit cost of (4.69)/450 = 0.010422 approximately which rounds to 0.01; so this unit cost is approximately $0.01 per gram or 1 cent per gram.

For the second box, its unit cost is (6.49)/600 = 0.0108167 approximately. When we round to the nearest cent, we get the same unit cost as before. Without rounding, we see that the first box has a slightly lower unit cost. Therefore box 1 is the better buy.

20% of what number is 75?

Answers

Answer:

15

Step-by-step explanation:

Answer:  375

Step-by-step explanation:

NEEDS TO BE CORRECT PLZ HELP

Answers

C

Step-by-step explanation:

Linear pair

it's hope it helpful to you

Answer:

c

Step-by-step explanation:

its a pair

209
У.
Х
120°
y = [ ? 1°

Answers

Answer:

140

Step-by-step explanation:

one exterior = the sum of two interior

Find the exact value of each variable that represents its side length in a right triangle. Please help me with this ASAP!

Answers

Answer:

[tex]h=6[/tex]

[tex]k=2.5[/tex]

[tex]m=\sqrt{21}[/tex]

[tex]n=3\sqrt{10}[/tex]

[tex]p=\sqrt{17}[/tex]

Step-by-step explanation:

We can use the Pythagorean Theorem in each case.

Pythagorean Theorem:

[tex]a^{2} +b^{2} =c^{2}[/tex]

Where [tex]a[/tex] and [tex]b[/tex] are two sides of a right-angle triangle and [tex]c[/tex] is Hypotenuse (the longest side opposite to the right angle)

For [tex]h[/tex]:

[tex]h^{2} +8^{2} =10^{2}[/tex]

[tex]h^{2} +64=100[/tex]

Subtract 64 from both sides:

[tex]h^{2} =100-64[/tex]

[tex]h^{2} =36\\[/tex]

[tex]h=\sqrt{36}[/tex]

[tex]h=6[/tex]

We follow the same process to find  [tex]k,m,n[/tex] and [tex]p[/tex].

answerrrrrrrrrrrrrrrrrr plzzzzzzz

Answers

Answer:

X=24

Step-by-step explanation:

55-31 is 24

Answer:

x+31°=55°[alternate angle]

x=55°-31°

x=24°

answer

what is the square root of 9 and 4

Answers

Answer:

3/2

Step-by-step explanation :

Square root of 9 and 4 is 3/2 because it just is

Ian​'s car can go 231 miles on 7 gallons of gas. During a drive last​ weekend, Ian used 5 gallons of gas. How far did he ​drive? Use pencil and paper. Explain how the problem changes if you were given the distance Ian drove last weekend instead of how much gas he used.

Answers

Answer:

165 miles

Step-by-step explanation:

part 1

231/7= 33 mpg

33x5 = 165 miles

part 2

distance/mpg = gas used

for example: if you were told he went 200 miles,

200/33 = 6.06 gallons of gas

Given :

Ian's car can go 231 miles on 7 gallons of gas.

During a drive last weekend, lan used

5gallons of gas.

To find :-

How far did he drive?

Solution :-

According to Question ,

Car can go 231 mi on 7 gallons of gas.

Using Unitary Method ,

On 1 gallon of gas it will go 231/7mi

On 5 , it will go 231/7*5 = q65 miles

Hence the required answer is 165 miles

Subtraction of integers
-70 --25 =

Answers

Answer:

-45

Step-by-step explanation:

-70 --25

-×-=+

-70 +25

-45

−4 + 20 > −8 what the answers

Answers

Answer: -20

Step-by-step explanation: plz mark me brainliest please?

2. Ms. De Los Santos bought 5 3/7 gallons of ice cream for the 6th grade Wakanda Day celebration. If each scholar is served 1/16 gallon of ice cream, what is the greatest number of scholars that can be served?

Answers

So we convert both to improper fractions.
38/7 and 1/16
Now we make them the same denominator
608/112 and 7/112
Now we divide 608 by 7
Maximum amount which can be given is 85 scholars.
Give me brainliest answer!

HELPPP PLEASEEE!!!!!!!

Answers

Answer:

CFX, ADC

Step-by-step explanation:

CFX is just a larger version of AEX. Same thing with CFX.

find the midpoint and distance between (5,1) and (-15,11)

Answers

Answer:

look i think is -5.005 I don't really know but I hope you get it right. Have a good day

A list of numbers is given below. If x is a number in this list, which inequality could represent x? {-5, -12, -2, -9}

Answers

Answer:

x<-1

Step-by-step explanation:

All of the numbers on/in the set are below -1. That means for that any of them to be x, the inequality would be x<-1.

636/526 pls answer and you get points

Answers

Answer:

1.20912547529

Step-by-step explanation:

please help me due soon

Answers

Answer:

- 7.2

Step-by-step explanation:

it is division and we need to take the reciprocal and multiply it will be -9/5. we need to simplify leaving us -7.2

A Bike rental place rents bikes for $22 plus $8 per hour. Mary paid $67 to rent a bike. Write and solve an equation to represent how many hours she rented the bike.

Answers

Answer:

8x+22=67

Step-by-step explanation:

Other Questions
0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest