An is good looking and well be haved (not only)

Answers

Answer 1

Not only is Ann good looking, but she is also well-behaved.

can have brainliest?


Related Questions

what are three benefits of networking while searching for a job

Answers

Answer:

Advance your career.

Get more knowledge.

Build some confidence.

Answer:

1. Raise your profile.

2. Advance your career.

3. Get access to job opportunities.

In which ways can ellipses be used correctly?

Answers

Answer:

The third orn

Explanation:

During class, the teacher calls Mateo up to their desk to ask him a question while he is working on a project. Which of the following is the first thing Mateo should do before leaving his seat?
A. Ask a friend to make sure no one touches his computer.
B. Power his computer completely off.
C. Nothing; he's at school, so no one will play with his device.
D. Lock his computer so no one can access it.

Answers

Answer:

1) c

2) b

3) a

4) a

5)b

Explanation: PLS MARK BRAINLIEST

The following is the first thing Mateo should do before leaving his seat in nothing; he's at school, so no one will play with his device. Thus, option (c) is correct.

What is school?

An educational institution is indicated by the word “school.” The classroom at school is a space where students are taught by teachers. Through the use of books, the learner is able to learn, practice reading and writing. The schools are the provided the education services.

According to what Mateo should do before leaving his place in the nothing, he should do at school on the device. Mateo should do nothing before leaving his seat; he is at school, so no one will mess with his device. They he was the play with his device.

As a result, the first thing Mateo should do before leaving his seat in nothing; he's at school, so no one will play with his device. Therefore, option (c) is correct.

Learn more about on school, here:

https://brainly.com/question/27601494

#SPJ2

In which sentence are the commas
placed correctly?
A. We went toward the shore got in a creek, landed
near a fence and there we remained till daylight.
B. I asked for biscuits, a loaf of bread, and cinnamon
rolls when I went to the bakery.
C. I certainly did seem to have a, most awkward,
ridiculous, and foolish appearance.

Answers

Answer:B

Explanation:used to show the sequence

Read the excerpt below and answer the question.
I therefore filled all the little spaces, that occurred between the remarkable days in the Calendar, with
proverbial sentences, chiefly such as inculcated industry and frugality, as the means of procuring wealth, and
thereby securing virtue; it being more difficult for a man in want to act always honestly, as (to use here one of
those proverbs), "It is hard for an empty sack to stand upright."
-Benjamin Franklin, "The Way to Wealth," 1758
Which of the following best explains the phrase, "it being more difficult for a man in want to act always honestly"?
frugality leads to wealth
o the spaces in the calendar needed to be filled
wealth makes people virtuous
the calendar includes proverbs

Answers

Answer:A: Frugality leads to wealth

Explanation:

sorry about that child...

Help please??!???!?????????

Answers

Answer: d

Explanation:

i think it is answer d because the only thing they talk about in the passage is business  

What is the importance of the way the author unfolds a series of events in the narrative "The Final Assault" by Sir Edmund Hillary?

Be sure to provide examples
from the text to support your analysis. Use evidence from the text to support your response. Your response should be one to two complete paragraphs.

Answers

The way the author unfolds a series of events allows the creation of a logical sequence, which allows the reader to understand where the idea of ​​climbing Mount Everest came from, the difficulties, conflicts, and resolution of this idea.

In other words, the events create a sequence that allows the book plot to advance.

Regarding "The Final Assault" we can say that:

The book portrays the dangers and emotions of climbing Mount Everest.The narrator shows the apprehension of climbing the hill from the moment the idea emerged.However, the narrator is excited and with a strong expectation of being successful.After that, a series of events takes place, giving movement to the plot and showing all the consequences of this idea.This creates a logical sequence, which shows how events are organized until the end of the book, being able to trigger different emotions in the reader.

With this, we can conclude that the presentation of events in a sequence is a way to show linearity in the story, allow the plot to advance, and control the readers' emotions.

More information:

https://brainly.com/question/6110309

Why is it important to have a written strategy for our
passions, goals, and dreams?

Answers

Answer:

just came here so you give the guy above me brainliest pls

Explanation:

someone pls help write a conclusion about bushfires some it up with these information altogether pls!!! I’ll brainlist u u have my word.

Answers

Answer:

subject?

Explanation:

Answer:

Bushfires are fires that spread rapidly through bush or shrub forests.

Explanation:

PLEASE MARK AS BRAINLIEST!!!!!

The words highlighted in YELLOW show the way the narrator translated her mother’s message to the stock broker. What is the effect of changing her mother’s emotional language to calmer language? Write your response below. The words in yellow are: , I’m getting rather concerned. You had agreed to send the check two weeks ago, but it hasn’t arrived.”“I can’t tolerate any more excuses. If I don’t receive the check immediately, I am going to have to speak to your manager when I’m in New York next week.” This is from "Mother's Tongue" By Amy Tan Also the text and other questions i have are on the attached!

Answers

Answer:

She can be happy exited or very emotional

Answer:

The effect of changing her mother’s emotional language to calmer language is that they could be more willing and understanding with her if she’s not yelling at them and using a more professional tone.

Explanation:

Think of it as if you were the one receiving the call from Mrs. Tan, you would not want to be yelled at or be accused of lying.

more than fifty miles per hour phrase or clause

Answers

Answer:

it is a phrase

Explanation:

Many people say that but they aren't really going more than fifty miles per hour

Use your ideas from step 2 and complete the email to Fernando

Answers

In step 2, we are told to think of an invention that we and a member of our family uses, what we do we it, when we use it and what is special about it. Using these pieces of information we will complete the email to Fernando below:

Dear Fernando,

How are you? I felt happy to read your email. Víctor Barraza and Rut Manzanares are  great Peruvian inventors.

Let me tell you about the inventions my mother and I use in everday life.

My mother's favorite invention is the blender. She blends tomatoes and other nuts with it. Usually, she uses it when preparing food in the kitchen. It is time-saving and hygienic.

As for me, my favorite innovation is the computer. I access the internet and type documents with it.

Generally, I use it while preparing my school projects. It is reliable and effective.

Bye-bye,

Fernando.

With the above, we have informed Fernando of the innovation that we and a member of the family use. Information about when we use it and why it is special to us is also included.

Learn more here:

https://brainly.com/question/16008657

What is the effect of Groucho’s shirt history of Casablanca

Answers

Answer:

The effect of Groucho's short history of Casablanca is to create a humour but yet also sarcasm scenario

Which statement about your financial needs is most accurate? A. Your financial needs will stay the same throughout your life. B. Your financial needs will change throughout your life. O C. Your financial needs will decrease as you get older. O D. Your financial needs will be totally predictable.​

Answers

Answer:

B. Your financial needs will change throughout your life.

Explanation:

Your financial needs will change throughout your life is the most accurate statement about financial needs. Hence, option B is correct.

What affects our financial needs ?

Financial needs can vary significantly depending on a person's age, income, expenses, goals, and life circumstances. For example, a young adult may have financial needs related to paying for college or starting a career, whereas a middle-aged adult may have financial needs related to saving for retirement or paying for their children's education.

As a person ages, their financial needs may continue to change, for instance, they may need to pay for healthcare expenses, long-term care, or estate planning.

Therefore, it's important to regularly reassess and adjust financial plans and goals as life circumstances change. Hence, option B is the correct statement.

Find more on financial needs:

https://brainly.com/question/30225564

#SPJ5

Which passage best reveals the character of Matre Hauchecome, the main character in "A Piece of String"? A. He inquired: "Is Matre Hauchecome of Breaute here?" B. The men were proceeding with slow steps, the whole body bent forward at each movement... C. He began to tell the story of the string. No one believed him. They laughed at him.​

Answers

Answer:

Very good question, also making me confused lol. I'm thinking it's a. But it could be C

Explanation:

Hope it helps

PLSSSSSSSSS HELPPPPPPPPPPPP HURRRRRYYYYYY!!!!!!

Answers

Explanation:

orange line goes to evidence

purple line goes to claim

Red line goes to rebuttal

Blue line goes to reason

Green line goes to claim

Answer:

orange line goes to evidence

purple line goes to claim

Red line goes to rebuttal

Blue line goes to reason

Green line goes to claim

Explanation:

hope this helps

your friend has informed you that his dad has decided not to look after him in school anymore. write to your friend's dad giving him at least 3 reasons why he should change his mind

Answers

Explanation:

Dear Friend's dad,

I have heard that you have decided not to look after your son in school anymore. I do not think that should happen because your son may only be succeeding in school because you are looking after him. You will also be unaware if your son does anything rash. I understand that he is not 12 anymore, but there is still much that can happen.

HELP
Read the excerpt from "Object Lesson, Part 2."

He leaned against Louise's desk, forcing himself to relax.

It was these "simple" problems. Nothing big and important like murder, blackmail, bank robbery. A miserable seven dollars lifted by a teenage delinquent in an overcrowded classroom . . .

He thought furiously.

Let the bell ring at 9:35 and the boy strut out of Miss Carpenter's room undetected, with his loot, and he would send up a howl like a wolf cub over his first kill.

What inference does Ellery make?

A. that he may pass out if he does not stop and relax

B. that there are harder problems to solve in the world

C. that the thief would not have committed the crime if there weren't so many students in the class

D. that the thief has no idea that Ellery is aware of his plans to steal the seven dollars.

Answers

Answer:

I'm sure d ans Is A

Ellery may pass out if he does not relax

Answer:

I think is C or A

Explanation:

Correct me if im wrong

Help me Make Sentence Present Continuous Tense from this picture (10 sentences) (Subject + Verb to be + Verb add ing) Thanks for help me :)

Answers

Some sentences we can make using the Present Continuous and the picture:

1. Three girls are jumping rope.

2. A boy is painting the bush.

3. The toys are playing hopscotch.

4. Two boys are playing on the see-saw.

5. A boy is eating a plate.

6. Four kids are going down the slide.

We use the Present Continuous tense to describe actions that are taking place at the moment.

The structure is: subject + verb to be + main verb (-ing).

Examples:

I am walking the dog now.

Sheila is watching TV.

The answers 1 - 6 above are sentences using the Present Continuous based on what is happening in the picture.

Learn more about the topic here:

https://brainly.com/question/24342132?referrer=searchResults

in the context of the story the monkeys
paw how do families
face death? when is it better to accept death and when is it better to fight against
it? how does each approach impact the people who still live?
Search instead for in the context of the story the monkeys paw how do families face death? when is
it better to accept death and when is it better to fight against it? how does each approach impat the
people who still live?

Answers

Taking the context of "The Monkey's Paw" into consideration, we can answer in the following manner:

1. According to the story, families may have a hard time facing the death of a family member. When someone dies, everyone suffers. Some, however, may accept the event better than others.

2. It is better to accept death when there is nothing one can do about it, when the person is already gone. It is better to fight death when the person is still alive, perhaps struggling with some illness. Then, it is good to fight, get treatment, deal with the problem.

3. Each approach has a different impact on people. If a family member dies and the others do not accept it, they will not be able to move on and heal from the trauma. That will certainly take a toll on their mental and physical health.

Accepting death may be better for those who are alive. They are better equipped to deal with reality and to move on.

"The Monkey's Paw" is a short story by W. W. Jacobs.A mummified monkey's paw is brought into the Whites' home. It is magical and can grant three wishes.The Whites are warned, however, that they should not use the paw. That bad things happen to those who use it.They use it anyway, and the first wish results in the death of their son.Mrs. White is unable to accept her son's death and makes her husband wish for their son's return.Mr. White makes the wish, and it seems to have worked. However, their son died in an awful manner, and his body was greatly harmed.Mr. White ends up wishing for his son to go away again.The story shows that accepting death is probably better for those who are still alive.Clinging to the past and to the memory of the person who died can have an emotional and psychological impact on those who are still here.

Learn more about the topic here:

https://brainly.com/question/20177631?referrer=searchResults

https://brainly.com/question/4801344?referrer=searchResults

why do parents look After their children? give two reason.​

Answers

Well it is because one;

They want their children to be safe and not hurt.

And two;

They don't want there children to get things that are not safe for them.

And another is;

It is there responsibility to take care of their children.

Many people believe that in order to success in learning English, learners should choose to learn " British English" or "American English"? Do you agree with this view? Explain your choice.

Answers

My opinion on how best to learn the English Language is;

Yes, people should either choose to learn "British English" or "American English".

For beginners who want to learn the English language successfully, they should either choose to learn "British English" or "American English".

The reason for this suggestion is that these two types of English language have peculiarities. Some words are not spelled the same in the two languages.

For example, 'labor' is acceptable in American English but the letter 'u' is added after 'o' in British English. Also, when using either of these two types of language in a text the same style must be maintained throughout.

So, if you are using American English in a text, you must maintain the same style throughout the text.

When a learner successfully masters either type of the language, then they can communicate effectively in English.

Learn more here:

https://brainly.com/question/18539871

What did the captain of the Dei Gratia decide to do when there was no response from anyone on the Mary Celeste?

He placed a call to the harbormaster in New York to find out more about the voyage of the Mary Celeste.

He suspected that the Mary Celeste's sailors had overthrown their captain and readied his own ship for battle.

He brought the Dei Gratia close enough to the Mary Celeste that he could board the ship himself.

He ordered three men to take a small boat over to the Mary Celeste and find out what was wrong.

Answers

Answer:

Third option, "He brought the Dei Gratia close enough to the Mary Celeste that he could board the ship himself."

Explanation:

This I'm Sure about, because I read about it while trying to answer your other question about this.

The captain of the Dei Gratia ordered three men to take a small boat to the Mary Celeste and investigate the situation when there was no response from anyone on board. Therefore, option D is correct.

"Mary Celeste," a maritime enigma veiled in salt-sprayed mist, is an echoing whisper across the boundless expanse, a ship forever etched in maritime lore. She sails through history's fog, her deserted decks and unanswered questions mirroring the unfathomable depths below.

Like a ghostly silhouette against the horizon, "Mary Celeste" conjures tales of vanished souls and whispered secrets, a vessel abandoned by her human guardians, leaving behind riddles that the tides of time continue to carry.

Her name evokes the mysteries of the deep, a maritime legend that echoes through centuries, a siren call to curiosity's yearning ear.

Therefore, option D is correct.

Learn more about Mary Celeste here:

https://brainly.com/question/28631624

#SPJ3

in evidence, what action do you do?​

Answers

dedicate to improving the lives of millions of people across Africa and Asia

Help!! I will give brainlest...

Read paragraph 3 in the passage. What does the name Warca-Ziwin mean?

A.
Sunflower
B.
Earth
C.
Bounding Deer
D.
River


] Returning from the river, I tugged beside my mother, with my hand upon the bucket I believed I was carrying.… I said: "Mother, when I am tall as my cousin Warca-Ziwin1, you shall not have to come for water. I will do it for you."

Answers

Answer:

If I am not mistaken, it could mean Sunflower.

Explanation:

I read something on it.

Sorry if this is wrong.

The context clues show that the name Warca-Ziwin mean is A. Sunflower.

What are context clues?

Context clues are the hints that are given on a literary work to help readers understand a story.

In this case, the context clues show that the name Warca-Ziwin mean is Sunflower.

In conclusion, the correct option is A.

Learn more about context clues on:

https://brainly.com/question/11247029

How effectively does the figurative language in this paragraph
advance the author's argument that Scouts is a valuable
organization?

Answers

Answer:

Wheres the Paragraph

Explanation:

And i can edit answer and will put the right answer after i have the paragraph

Sentence Scramble

Directions: The sentences below are jumbled. Reorganize them into the
correct order to reveal the history of Flamin' Hot Cheetos.

Richard took those Cheetos home and topped them with chili powder. Soon afterwards, he pitched his idea for a spícier
version of Cheetos to company executives.

Hot Cheetos were created by a janitor, Richard Montanez,
who had been working in the Frito-Lay plant in California
since 1976.

Flamin' Hot Cheetos are one of the most popular snacks
among students today, but do you know the history of these
tasty chips?

His idea was accepted, and he is now in charge of the
Frito-Lay Hispanic marketing team.

One day, a machine at the factory malfunctioned and some Cheetos were not dusted with the famous orange powder.

Answers

Flamin' Hot Cheetos are one of the most popular snacks

among students today, but do you know the history of these

tasty chips?

Hot Cheetos were created by a janitor, Richard Montanez,

who had been working in the Frito-Lay plant in California

since 1976.

One day, a machine at the factory malfunctioned and some Cheetos were not dusted with the famous orange powder.

Richard took those Cheetos home and topped them with chili powder. Soon afterwards, he pitched his idea for a spícier  version of Cheetos to company executives.

His idea was accepted, and he is now in charge of the

Frito-Lay Hispanic marketing team.

write a poem about a golden retriever
please help !! lol

Answers

I hope that the attachment helps you...

Cold rain suddenly splashed on the metal bleachers

Answers

Answer:

Cheese

Explanation:

Yos

8.sınıf more and more fame fenomen cevap anahtarı​

Answers

Answer:

okeh

Explanation:

Other Questions
It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above a _____ is a telecommunications network that connects users and their computers in a geographical area that spans a campus or a city. Pls help, will give brainliest Why did the U.S. force the tribes to renew their treaties after the Civil War? 133.5 divided by 5 show work! please helpsuppose you work for a large company create a short memo letting your coworker know that July 3 is also a paid holiday which individual from the renaissance was one of the earliest artists to paint rounded, lifelike figures in natural settings? 5 by 8 of the children in the field are girls. There are 45 boys. How many girls are there? which pair of alternatives is highlighted by the life cycle of the cellular slime molds, such as dictyostelium? 6.How does the organization of this text help the reader understand theargument? in the upper limb, the brachial artery can be found ___________.