will mark brainlyist if right
What chemical change occurs to ATP when it reacts with water and releases energy?

a
The ATP molecule loses a phosphate, becoming ADP.
b
ATP binds to chlorophyll to allow plants to use the sun's energy.
c
The ATP molecule gains a phosphate, becoming ADP.
d
The ATP molecule becomes membrane bound as a sodium-potassium pump.

Answers

Answer 1

Answer:

the other person was right

Explanation:

a. the ATP molecule loses a phosphate become ADP


Related Questions

In animal cells, what are the holes between directly connected cells used for intercellular communication called?

Answers

Answer:

However, they do have specialized junctions called plasmodesmata (singular, plasmodesma), places where a hole is punched in the cell wall to allow direct cytoplasmic exchange between two cells.

Explanation:

The tail of a comet always points towards the sun true or false​

Answers

False , it will always point away because the radiation pressure of the sunlight

What percentage of the entire reef did the scientist sample

Answers

Answer:

As a result, over 50 percent of the world's coral reefs have died in the last 30 years and up to 90 percent may die within the next century—very few pristine coral reefs still exist.

Explanation:

As a result, over 50 percent of the world's coral reefs have died in the last 30 years and up to 90 percent may die within the next century—very few pristine coral reefs still exist.

What are coral reefs?

A coral reef is an underwater ecosystem characterized by reef-building corals. Reefs are formed of colonies of coral polyps held together by calcium carbonate. Most coral reefs are built from stony corals, whose polyps cluster in groups.

Coral reefs are massive structures made of limestone deposited by coral polyps. Often referred to as the “rainforests of the sea,” coral reefs support approximately 25 percent of all known marine species.

Coral reefs protect coastlines from storms and erosion, provide jobs for local communities, and offer opportunities for recreation. They are also are a source of food and new medicines. Over half a billion people depend on reefs for food, income, and protection.

Learn more about coral reefs:

https://brainly.com/question/21965144

#SPJ2

organisms that gain energy by consuming preexisting organic molecules are called:

Answers

Answer:

heterotrophs

Explanation:

Does the amount of energy from the food eaten (Kcal) by each organism equal the amount of energy used by each organism? Support your answer by showing your calculations. (Show your work > math icon)

Answers

Answer:

Explanation:

This continues on, all the way up to the top of the food chain. About 50% of the energy (possibly as much as 90%) in food is lost at each trophic level when an organism is eaten, so it is less efficient to be a higher order consumer than a primary consumer.

List the 5 Factors that influence Climate

Answers

+ wind patterns
+ elevation/altitude
+ temperature
+ distance from sea
+ latitude

Answer:

Latitude, Altitude, Winds, Distance from the sea, relief

Explanation:

Describe the relationship between glucose, insulin, and diabetes. Explain what the condition of
diabetes is, what some of the negative effects are, and how we treat it. In your answer, include the
terms carbohydrates and proteins in your answer as well.

Answers

Answer:

Blood sugar enters your bloodstream, which signals the pancreas to release insulin. Insulin helps blood sugar enter the body's cells so it can be used for energy.  (ANSWER)

Explanation:

Blood sugar enters your bloodstream, which signals the pancreas to release insulin. Insulin helps blood sugar enter the body's cells so it can be used for energy. (ANSWER)

Explain how products produced by photosynthesis relate to those used by respiration.​

Answers

Answer:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. ... Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

Explanation:

what would happen to the variation between organisms in a population if their dna polymerase did not have a proofreading function?

Answers

Answer:

What would happen to the variation between organisms in a population if their DNA polymerases did not have a proofreading function? ... It unwinds DNA.

Explanation:

write an article on the topic 'impact of population on ecosystem'.

Answers

Abstract -

The rapid increase of human population is putting an incredible strain on our environment. While developed countries continue to pollute the environment and deplete its resources, developing countries are under increasing pressure to compete economically and their industrial advancements are damaging as well. The demands that this growth places on our global environment are threatening the future of sustainable life on earth. One of the largest environmental effects of human population growth is the problem of global warming. Some scientists fear that global warming will lead to rising sea levels and extreme weather conditions in the future. In order to support the growing population, forests are being destroyed at an alarming rate. Humans also continue to put a great demand on the natural resources of our planet. Many non-renewable resources are being depleted due to the unrestrained use of fuel and energy. Many parts of the world also suffer from a shortage of food and water. The growth of population puts larger demands on our already limited resources. The environment on earth is suffering from the growth of global population. The depletion of resources and biodiversity, the production of waste, and the destroying of natural habitat are serious problems that must be addressed in order to ensure that life on earth will be sustainable throughout the next century. Keywords: Industrial advancements, Land and soil degradation, global warming, Climate change, Air and water pollution, Deforestation, Physical environment.

I GIVE BRAINLIST ON ALL MY QUESTIONS!!
Which of the following statements is true about photosynthesis and cellular respiration?

A) the steps in processes are very similar to each other

B) photosynthesis occurs in plants; cellular respiration occurs in animals

C) the chemical equations for the processes are opposite of each other

D) both processes are carried out in the same location of the cell

Answers

Answer:A or C

Explanation:im not really sure but yeah

Answer:

The answer is C

Explanation:

I took the quiz

and the other answers for the quiz are

Q1: oxygen

Q2: Glucose breakdown would nearly stop or cease entirely.

Q3:anaerobic respiration

Q4:The chemical equations for the processes are opposite of each other.

Guys pls help me!!!!!!!!!

Answers


Trough is the the lowest point of a wave

Amplitude is the highest point of a wave

Spectrum is the amount of vibration at each individual frequency

Doppler effect is the changes in frequency of any kind of sound or light wave produced by a moving source with respect to an observer

With that I think the answer is b, but do what you think.

Hope this helps

in the correct order, what are the three major arteries that branch off the aortic arch?

Answers

the brachiocephalic artery (which divides into right common carotid artery and the right subclavian artery), the left common carotid artery, and the left subclavian artery.

PLEASE HELP!!!!!
LINK GET REPORTED
Select the statement that is true. (1 point)
O DNA and RNA are both double-stranded
O Translation copies DNA to mRNA, while transcription converts mRNA into proteins.
O Thymine is only present in DNA, while cytosine is only present in RNA
O DNA has the sugar deoxyribose, while RNA has the sugar ribose.

Answers

I believe it's B

DNA is blueprint

mRNA is making the blueprint (If I recall correctly)

D is my 2nd best choice if I'm wrong

How does bromothymol blue act as an indicator for carbon dioxide? What evidence do you have to support your conclusion?

Answers

Answer:

Carbon dioxide production can be measured by breathing through a straw into a solution of bromothymol blue (BTB).

Explanation:

BTB is an acid indicator; when it reacts with acid it turns from blue to yellow. The more carbon dioxide you breathe into the BTB solution, the faster it will change color to yellow.

Which traits in the investigation showed incomplete dominance?

Answers

Answer:

A child born with semi-curly/wavy hair

Explanation:

A child born with semi-curly/wavy hair is individuals exhibiting incomplete dominance because the crossing of parents alleles both straight and curly hairs to produce such offspring. Thus, incomplete dominance occurs to produce an intermediate trait between the two parent traits.

Hope this helps!! Brainliest?? Anyways have a great day!! :))

Question 6
What would an ecologist use latitude to describe?
O A) the average weather conditions of a specific location
OB) the distance of a point from Earth's prime meridian
O C) the distance of a point from the Earth's equator
D) the distance of a point from the Earth's north pole
Next Question
what would and ecologist use latitude to describe?

Answers

Answer:

c the point of distance from the earths equator

Explanation:

Latitude measures equator distance. Latitude lines travel east-west parallel to the equator from 0 degrees latitude.Therefore, option (C) is correct.

What is a latitude?

Latitude is a type of coordinate that indicates the position of a place on the surface of the Earth or another celestial body in relation to the north and south poles. When expressed as an angle, latitude can run anywhere from –90 degrees at the south pole to 90 degrees at the north pole, with 0 degrees denoting the equator.

The equator, located at 0 degrees, the Tropic of Capricorn, located at 23.5 degrees south, the Tropic of Cancer, located at 23.5 degrees north, the Antarctic Circle, located at 66.5 degrees south, the Arctic Circle, located at 66.5 degrees north, the South Pole, located at 90 degrees south, and the North Pole, located at 90 degrees north are the seven significant lines of latitude.

Learn more about latitudes, here:

https://brainly.com/question/28606059

#SPJ2

What is the purpose of a plant cell wall?

Answers

Answer:

provides tensile strength and protection against mechanical and osmotic stress. 

This picture shows part of a mangrove swamp in the Florida Everglades. Mangroves are trees that can live in fresh water or salt water. This means that the Everglades is most likely

Answers

Answer:

The answer is B (An estuary)

Explanation

The picture depicts a mangrove swamp within Florida Everglades. This means that the Everglades is most likely Estuary due to the presence of mangrove trees thriving in both freshwater and saltwater environments. The correct option is (B).

The picture shows a mangrove swamp in a section of the Florida Everglades. Mangroves are unusual trees that have the amazing capacity to thrive in both freshwater and saltwater environments. Estuaries, where rivers meet the sea and create a setting with variable salt levels, are notable for this adaptability.

The Florida Everglades is a perfect example of an estuary environment since the coexistence of mangroves in this ecosystem implies the presence of brackish water, which is a mixture of freshwater and seawater. Estuaries are key for maintaining a variety of wildlife and offering crucial ecological functions.

To know more about mangrove here https://brainly.com/question/26556496

#SPJ3

The given question is incomplete, complete question is- "This means that the Everglades is most likely

(A) a lake.

(B) an estuary.

(C) a river.

(D) deep ocean"

what is the potential limiting factor for the wolf population​

Answers

Wolf predation is a large limiting factor of many population. Predation by wolves can be density-dependent and regulate prey populations at low densities. In some situations, wolf predation can eliminate prey populations.

Answer:

There are several. Potential limiting factors for a wolf's population include, but are not limited to, food, water, habitat, mates, etc.

Explanation:

Have a great day, and spread some positivity!

which type of skeletal muscle fiber is most important for an athlete running a 40 meter sprint?

Answers

fast glycolytic fibers

Lactic acid fermentation can be modeled by which equation?
O Lactic acid + NADH → Pyruvic acid NADH
O Pyruvic acid + NAD+ → Lactic acid + NADH
O Lactic acid + NADH → Pyruvic acid + NAD+
O Pyruvic acid + NADH → Lactic acid + NAD+

Answers

Lactic acid fermentation can be modeled by the following equation: Pyruvic acid + NADHLactic acid + NAD+

LACTIC ACID FERMENTATION:

Fermentation is a process undergone by some anaerobic organisms. Ideally, the process of cellular respiration proceeds as follows in the presence of oxygen: Glycolysis- Kreb cycle - ETC.

However, in the absence of oxygen (anaerobic condition), the product of glycolysis which is pyruvic acid combines with an electron carrier (NADH) to give rise to lactic acid and NAD+.

This means that pyruvic acid is reduced while NADH is oxidized as modelled in the following equation:

Pyruvic acid + NADHLactic acid + NAD+

Learn more at: https://brainly.com/question/11502989?referrer=searchResults

Answer to Question 1:

Well, given the choices to the question above 'Lactic acid fermentation can be modeled by which equation?', I would say that the best choice would be 'Pyruvic acid + NADH → Lactic acid + NAD+', or in other words, Option D.

Explanation for Question 1:

For a further explanation expanding more on the first question and showing why, the user above's answer is super helpful.

Answer to Question 2:

For the additional question asked 'In the Krebs cycle, how is citric acid formed?', I didn't see the options, however I believe they are:

O Carbon dioxide bonds with a chain of coenzyme A.

O Pyruvic acid molecules are broken down by an acetyl group.

O Acetyl-CoA joins with a large molecule called ozaloacetic acid.

O Enzymes combine hydrogen ions, oxygen, and electrons.

^ This being said, I would say your best choice would be Option C.

Explanation for Question 2:

The Krebs cycle begins when acetyl-CoA combines with a four-carbon molecule called OAA, aka oxaloacetate. This begins to produce citric acid, in which has six carbon-atoms. This is why the Krebs cycle is also referred to as 'the citric acid cycle.'

~Thank you for asking your question here on Brainly. Hope we helped :D Happy holidays!

new seed does not germinate in spite of suitable environment.why?

Answers

Answer: Dormancy facilitates that germination only takes place at the optimal moment.

Explanation: This can be due to the fact that dormancy facilitates that germination only takes place at the optimal moment, in spite of changes in the environment, due either to weather phenomena, or whether due to the fact that the seeds reach a new location after dispersal.

2. Which statement about nuclear fission is false?
Nuclear fission is used to generate electricity at nuclear power plants.
Nuclear fission takes place in the core of stars.
Nuclear fission releases large amount of energy.
The fuel for nuclear fission is often uranium.

Answers

Answer:

"Nuclear fission takes place in the core of stars."

this statement is false

help me with these questions​

Answers

Answer:

1. land

2. crops

3. lack

4. Plants, people

Hope it helps.

Critical Thinking When lipid is added to a solution of a detergent in water, the detergent breaks
up large globules of the lipid into much smaller globules. What effect do you think a detergent would
have on the integrity of cells? Explain your answer.

Answers

Hghhhhhhhhhhhhhhhhhhhhhhhhjj

Answer: The cell would break apart.

Explanation:

Because Detergent breaks apart lipids, it would destroy the phospholipid bilayer, causing the whole cell to fall apart.

10. If an A (adenine) is exchanged for a C (cytosine) in a gene, it is a:

Answers

Answer:

Explanation:

A mutation occurs, and cytosine is replaced with adenine. ... (Figure) Adenine is larger than cytosine and will not be able to base pair properly with the guanine on the opposing strand. This will cause the DNA to bulge.

which cortex has six layers of the cells and pyramidal neuron as a principal cell?

Answers

Answer:

The cerebral cortex consists of neurons, nerve fibers and neuroglia. The cerebral cortex (neocortex) consists of six layers (in human the primitive arrangement into three layers persists only in the olfactory cortex and the cortical part of the limbic system in the temporal lobe).

Explanation:

Hope this helps...

wa i afunwhich meal would provide he most energy as well as as the material needed to build muscle

Answers

Answer:

Whichever meal is the highest in protein.

Explanation:

Protein keeps you feeling fuller for longer, gives you long term energy and it also helps build muscle.

fill in the venn diagram below with the following terms:exocytosis,diffusion,endocytosis,osmosis

Answers

Answer:

there more tissues or more organs in your body explain your reasoning

Explanation:

Each organ is made up of several different types of tissue. Therefore, for every organ in the body, there are many more tissues.

Answer: Venn diagram of exocytosis , diffusion , endocytosis , osmosis is

described below.

Explanation:

Exocytosis: refers to the  process by which the contents of a cell are released to the exterior environment  through fusion of the vacuole membrane with the cell membrane.

Endocytosis: refers to the process in which cells take the material from outside the cell by taking in the vesicle. These materials serve as nutrients and pathogens which help cell to fight against foreign diseases.

The common thing these two process have among them is

FlagellaPlasma MembraneCell divisionCytoplasmRibosomes chromosomes

Diffusion: It is the process of movement of molecules from through a

semipermeable membrane from the region of higher concentration to lower concentration.

Osmosis: The movement of water molecules from a solution with a high concentration of water molecules to a solution with a lower concentration of water molecules, through a cell's fractionally  permeable membrane.

The common thing these two process have among them is that equalizes the concentration of two solutions in mixture

Learn more about exocytosis , diffusion , endocytosis , osmosis.

https://brainly.com/question/24990392

#SPJ2

Other Questions
June follows a special diet that does not allow her to eat any milk products. This diet could be __________.A.vegan, lactose-free, or diabeticB.lactose-free, vegan, or ovo-vegetarianC.kosher, lactose-free, or low-sodiumD.diabetic, lacto-vegetarian, or low-sodium Solve for b.Help pls thank u !!!! Lin is paid $86 for 4 hours of work how much would she be paid at this rate for 9 hours of work? A chess club 20 with members is electing a new president. Lashonda received 8 votes. What percentage of the club members voted for Lashonda? 0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty?