Least common multiple of 168 and 76

Answers

Answer 1

Answer:

Best to draw out a factor tree.

Answer 2

Answer:

3192

this is the answer but if you need to show work then I can't help ya bud


Related Questions

what is the ratio of hearts to suns write your answer in simplest form for example 8:6 is equivalent to to 4:3

Answers

Step-by-step explanation:

this is the answer

please follow me and mark me as a brainlist

How many 1/5 cm can be cut from a 30 cm piece of ribbon

Answers

Answer:

6 ang

Step-by-step explanation:

mark me as brainliest

1-The diameter and a tangent are parallel.

A) always true

B) never true

2-The tangent at point B and the radius to point B are perpendicular to each other.

A) always true

B) never true

Answers

Answer:

always true always true

$12 per 45 minutes is how much an hour? (I will give good rating to anyone who answers)

Answers

Answer:

$16

Step-by-step explanation:

1. Simplify 12/45 which is now 4/15. Now we know $4 is made every 15 minutes.

2. Divide into 60(minutes) by the the 15. So 60÷15=4. Now we the number of times 15 can be divided into 60.

3. Multiply the ratio 4/15 by 4/4 to see how much is made in an hour. 4x4/15×4=16/60.

$16 is made in 60 minutes (1 hour).

please help teacher mean

Answers

218/21 — all added


10 8/21 — simplified

10.380952 — decimal this repeats :)

I get paid $12 per hour. what is time and half for every hour over 40 hours

Answers

Answer:

1.5

Step-by-step explanation:

To find the employee's regular earnings, multiply their regular pay rate ($12) by 40 hours. Next, calculate the employee's time and a half pay rate. Multiply 1.5 by the employee's regular rate of pay.

Answer:

480 would be your answer

Step-by-step explanation:

Which of these expressions are equal to 4? Select THREE that apply.

Answers

There’s no picture- send me a picture and I’ll be happy to help

How are x and y related in the equation 7 (x - y) = 0?
O = -Y
O x=y
O 7x = y
O 7x = -Y

Answers

b is the correct answer, i believe

can some 1 help me please

Answers

Answer:

ygghjhghccghhfghjkvgnkvvnvcvbvf

What would you need help with

Please can someone help? As i'm not confident this is right for factorising 4b^2 + 8b + 3 ​

Answers

Answer:

your answer is correct

Step-by-step explanation:

4b² + 8b + 3

Consider the factors of the product of the coefficient of the b² term and the constant term which sum to give the coefficient of the b- term.

product = 4 × 3 = 12 and sum = + 8

The factors are 2 and 6

Use these factors to split the b- term

4b² + 2b + 6b + 3 ( factor the first/second and third/fourth terms )

= 2b(2b + 1) + 3(2b + 1) ← factor out (2b + 1) from each term

= (2b + 1)(2b + 3)

Find the product of the sum of 52 and 18 and the difference of 86 and 41.

Answers

Answer:

2450

Step-by-step explanation:

52+18=70

86-41=45

70×45=2450

The product of the sum of 52 and 18 and the difference of 86 and 41 is 3150.

What is expression?In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is the sum of 52 and 18 and the difference of 86 and 41.

We can write the expression as -

{x} = (52 + 18) x (86 - 41)

{x} = 70 x 45

{x} = 3150

Therefore, the product of the sum of 52 and 18 and the difference of 86 and 41 is 3150.

To solve more questions on expressions, visit the link below -

brainly.com/question/1041084

#SPJ2

Use the distributive property to write an equivalent expression to -4(p+ 4) that
has no grouping symbols.
please help

Answers

Answer:

-4p-16

Step-by-step explanation:

Your job is to sell headbands for each headband that you sell at headbands R us you earn a commission of $1.25 if you do not sell any headbands you do not earn any money

Answers

Answer:

10 headbands = $12.50

Step-by-step explanation:

1) The function equation that represents the relationship between the number of headbands sold (x) and the commission earned (S) is: S = 1.25 * x. For each headband sold, you earn a commission of $1.25.

2) The point (5, 6.5) is not a solution for the function. When you sell 5 headbands, the commission earned should be $6.25, not $6.5.

3) A solution that does not appear in the table is (10, 12.50). Selling 10 headbands would result in a commission of $12.50.

1.

To complete the table, we can use the given information that for each headband sold, you earn a commission of $1.25.

Function Rule (Commission S): The function equation that represents the relationship between the number of headbands sold (x) and the commission earned (S) is:

S = 1.25 * x

Now, we can use this function to fill in the table:

Number of Headbands Sold (x) | Commission (S)

0 | 0 * 1.25 = $0 (No commission earned for 0 headbands sold)

1 | 1 * 1.25 = $1.25

2 | 2 * 1.25 = $2.50

3 | 3 * 1.25 = $3.75

7 | 7 * 1.25 = $8.75

15 | 15 * 1.25 = $18.75

32.50 | 32.50 * 1.25 = $40.625 (The value in the table seems to be a typo, it should be 32.50 * 1.25 = $40.625)

2.

To check if (5, 6.5) is a solution for the function, we need to see if the commission earned (S) matches with the given number of headbands sold (x) for that point.

Given (x, S) = (5, 6.5)

Using the function rule: S = 1.25 * x

S = 1.25 * 5 = 6.25

The commission earned (S) is $6.25, not $6.5. Therefore, (5, 6.5) is not a solution for the function as the value of S does not match.

3.

To identify a solution that does not appear in the table, we can select any number of headbands sold (x) and calculate the corresponding commission (S) using the function rule.

For example, let's choose x = 10:

Using the function rule: S = 1.25 * 10 = $12.50

So, a solution that does not appear in the table is (10, 12.50), where 10 headbands sold results in a $12.50 commission.

Learn more about Function Rule from the link given below.

https://brainly.com/question/10705186

#SPJ2

Polynomials

Multiply 5x(x2 - 4x+2)

Answers

Answer:

[tex]5x^3-20x^2+10x[/tex]

Answer:

-10x(x-1)

Step-by-step explanation:

5x(2x-4x+2)

10x^2-20x^2+10x

-10x^2+10x

-10x(x-1)

Which of the following is the graph of y=√-x-3?

Answers

Answer:

3

Step-by-step explanation:

Answer:

3

Step-by-step explanation:

-x-3 ≥ 0

-x ≥ 3

x ≤ -3

you have $50 in your bank account. Each week you plan to deposit $7 from your allowance and $10 from your paycheck. The equation b= 50 + (10 + 7)w gives the amount b in your account after w weeks. How many weeks from now will you have $150 in your bank account?

Answers

Answer:

Step-by-step explanation:

It will take 6weeks for you to have$150

Someone please help

Answers

Answer:

Step-by-step explanation:

Loading,please wait...

The sum of twice a number and seven less than four times a number is fifteen

Answers

7 + 2X = 15
2x = 8
x = 4

mark me brainiest if helped
2x + (4x - 7) = 15
6x - 7 = 15
6x = 22
x = 3 2/3

What is the function of this graph ?

Answers

Answer:

awedawedwadddddddddddddddddddddddddddddddd

Step-by-step explanation:

awedwadawaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

if x < 0, y > 0, and x + y = z, which statement about z is true?

Answers

Answer:

Z is greater than zero because it equals 1 or more.

Step-by-step explanation:

X/Y/Z=1+

7x^2-4+6x^3-4x-x^4 in standard form?

Answers

Answer:

-x^4 + 6x^3 + 7x^2 -4x -4      

Step-by-step explanation:

= -(x+1)(x^3-7x^+4 / factor the expression

A circle is placed in a square with a side length of 18cm, as shown below. Find the area of the shaded region. Use the value 3.14 for , and do not round your answer. Be sure to include the correct unit in your answer.

Answers

Answer:

92658

Step-by-step explanation:

jdbshe hzvx

nxgsbdxyxbhxgx6666

The function f is defined by the following rule.
f(x) = 3x-1
Complete the function table.

Answers

Answer:

hope it helps

...

.........


A baseball pitcher has pitched 82 2/3 Innings. What is the number of innings written as a decimal?




Answers

82.66666667 (this rounded) if you want the non rounded version this is the answer:

82.6666666666666666

The 6’s will go on forever so, in your answer you need to put a horizontal line on top of the six:

Ex. _
82.66


Any of these answers are correct, you can choose which to use. The safest answer would be the last one that has the line on top.

Pls mark brainliest :)

8) -4+41-5 +9pl = 48

Answers

Answer:

L= -11/9p

Step-by-step explanation:

put me brailiest

Answer
L= -11/9 p
:)))

Solve -9 2/7 - (-10 3/7).
A. - 1 1/7

B. 1 1/7

C. 19 1/7

D. 19 5/7

Answers

Answer:

1 5/7

Step-by-step explanation:

-9 2/7 -(-10 3/7) recall -×- = +

-9 2/7 +10 3/7

1 2+3/7

1 5/7

A politician has $4,200 to buy TV advertisements. If each advertisement costs $700, how many advertisements can the politician buy?

Answers

Answer:

He can but 6 ads

Step-by-step explanation:

how i thought of it was what times 700 hundred gives me 4,200 and i used the math that i have been taught and put together 6

Answer:

8

Step-by-step explanation:

4200÷7=

.................................

Find the value of x ?

Answers

Answer:

x = 232

Step-by-step explanation:

We know the measure of two angles now if you add both of them (90 +38) it will get u to 128now subtract 128 from 360and it will give u 232.

How many groups of 3/4 are in 4 1/2

Answers

Answer:

5 1/2

Step-by-step explanation:

3/4+3/4+3/4+3/4+3/4+1/2= 4.25

4.25 = 4 1/2

The number of 3/4 groups is 6.

What is a fraction?

A fraction is written in the form of a numerator and a denominator where the denominator is greater that the numerator.

Example: 1/2, 1/3 is a fraction.

We have,

Total amount = 4(1/2) = 9/2

The number of groups.

= 9/2 ÷ 3/4

= 9/2 x 4/3

= 6

Thus,

There are 6 groups of 3/4.

Learn more about fractions here:

https://brainly.com/question/24370499

#SPJ2

Choose a factor pair of 36.Show how this factor pair can be found in the prime factorization of 36

Answers

Answer:

2*2*3*3

Step-by-step explanation:

https://math.answers.com/Q/How_can_you_use_prime...

Other Questions
Solve for b.Help pls thank u !!!! Lin is paid $86 for 4 hours of work how much would she be paid at this rate for 9 hours of work? A chess club 20 with members is electing a new president. Lashonda received 8 votes. What percentage of the club members voted for Lashonda? 0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts?