How did foreign changes present new challenges for the United States?
(from the 1980s )

Answers

Answer 1

Answer:

There were lots of foreign changes that presented challenges for the US. I'll give you a few examples from different time periods. The first would be when England wanted to tax the Americans in the Revolutionary period. They did this to try and restrict America's freedom. Another example would be that Russia had spies during the cold war period. This was to gain intelligence of the US war plans. Also when Germany sent the Zimmerman Telegram to Mexico during the WWII period. This was to get Mexico to launch a surprise attack on the US.

ANSWER CREDIT GOES TO: 1v1MeRust


Related Questions

California to ban gas lawn mowers, leaf blowers do you belivee california have right there ?

Answers

California will become the first state to ban the sale of gas-powered leaf blowers and lawn mowers under legislation signed by Gov. Gavin Newsom.

Explanation:

Somebody help me please

Answers

Answer:

just give your opinion, they said no right or wrong! just put what you feel right! <3

Answer:

1, 2, 3

Explanation:

Since this is an opinion question I feel that rebuilding the south could not begin until the south could support freed men and women.

Supporting those groups could also only be done after they decreased resentment (most people would have a hard time supporting someone that they hate).

What system of writing was developed in ancient China from an early form of writing?

Answers

Answer:

Jiaguwen

This ancient writing system, called Jiaguwen, was pictographic, meaning each symbol represented a physical object. Later scripts would become more abstract, using characters to represent a variety of ideas until a single script was standardized under the Qin Dynasty

The system of writing was developed in ancient China from an early form of writing was Jiaguwen. It was in a pictographic.

What do you understand by the china writing?

The majority of academics concur that Mesopotamia is where the first writing was produced almost 5,500 years ago (present-day Iraq).

Early pictorial signs were progressively replaced by a sophisticated system of symbols that represented the sounds of various languages and the Sumerian language, which was spoken in Southern Mesopotamia.

This historic writing system, known as Jiaguwen, was pictographic, which meant that each symbol represented a real-world item.

The Qin Dynasty introduced a single script that would later grow more abstract and use characters to represent different ideas.

Therefore, the system of writing was developed in ancient China from an early form of writing was Jiaguwen. It was in a pictographic.

To know more about the china writing,  visit:

https://brainly.com/question/26720511

#SPJ2

__________ are the constitutional means referred to in Federalist Paper No. 51.
a. Separation of powers
b. The Supremacy Clause in Article VI of the Constitution
c. The Full Faith and Credit Clause in Article IV of the Constitution
d. Checks and balances
e. The mathematical formula used to calculate the distribution of seats within the House of Representatives

Answers

Answer:

I believe D.) Checks and balances should be the answer here.

Explanation:

In the Federalist Paper, James Madison talks about and defends the checks and balances system in the Constitution.

Answer:

D. Checks and balances

Explanation:

Checks and balances are the constitutional means referred to in Federalist Paper No. 51.

The Voting Rights Act ended

Answers

Answer:

b. literacy tests.

Explanation:

Answer:

b or c

Explanation:

i think its c

Did the emperor of the Incan empire ware a headdress made of gold with a fringe of red wool tassels across his forehead?

Answers

Answer:

Yes.

Explanation:

Source: the web

...................

Select the correct location on the map


Which city did the romans destroy at the end of the third Punic war?

Answers

Answer:

Carthage

Explanation:

In the Concert of Europe, the nations agreed to work together in support of what? Who else did conservative ideas appeal to?

Answers

Answer:

dgnn kkk,n h   hhnnnkl hygbnn hmm

what are 3 fun interesting facts about women in world war 1

Answers

Answer:

1. Women took on new roles in the work force, notably in war production and agriculture.

2. In 1914, the German armaments producer Krupp employed almost no women.

3. By 1917, women made up nearly 30 percent of its 175,000 workers and a nationwide total of nearly 1.4 million German women were employed in the war labor force.

Explanation:

Answer:

they where only useful for cooking, cleaning, and they brung men supplies for war.

Explanation:

which issue created a major conflict between state and federal governments one that we switched to resolve by a powerful and assertive Federal response​

Answers

1860 -- The Civil War: Testing Federalism. Civil War addressed two central issues: 1) the role of the federal government and 2) the nature of the union.

Explanation:

Answer:

racial segregation

Explanation:

took the test and got 100%

16. Who were the Jacobins during the French Revolution??

What’s the answer?

Answers

Answer:

A Jacobin  was a member of the Jacobin Club, a revolutionary political movement that was the most famous political club during the French Revolution (1789–1799). The club got its name from meeting at the Dominican rue Saint-Honoré Monastery of the Jacobins.

Explanation:

Pull factors are

A

reasons to leave a place

B pieces of culture that spread from place to place

С

reasons to go to a new place

forces that make a person move involuntarily

Answers

reasons to go to a new place :)
D. Reasons to go to a new place
Explantation: Pull factor is a geography phrase that is utilized to define factors that captivates people to a region, religion, organization, etc. Oppostite to push factor.

What is most likely the meaning of the word feat?

celebration
achievement
enterprise
idea

Answers

Answer:

enterprise

Explanation:

cause it mean coruge and steagth

Answer:

achievement

Explanation:

a feat is like your accomplishments or tasks you've completed

Here is the other question so plz help asap

Answers

A.) the proclamation prohibited colonists from settling on lands acquired from the French following the French and Indian War
B.) I’m unsure on this but They might have been frustrated because they felt the Proclamation was a plot to keep them under the strict control of England

The Bill of Rights was added to the US Constitution in order to

Answers

protect the individuals/people from the national government from having too much power

am I eating an ice cream cone rn

Answers

Answer:

I want some, what flavor is it

how can international intervention alter the course of civil wars?

Answers

Answer:

That is a slippery slope

Explanation:

Let me start by saying that I hope this is an extended response question.

So lets start with the American Civil War. There was virtually no International involvement in this war, outside of the British half-heartedly trying to run Union blockades to give the Confederates weapons and recieve Reb cotton. At the battle of Gettysburg in July of 1863, Col. William Freemantle of Her Magesties Royal Dragoons (British Special Forces) was attatched to the Confederate Army with R. E. Lee to research the idea of the British supporting the confederates with troops. The lack of international intervention allowed America to fight a war that needed fought, end slavery, and preserve the Union.

Now, look at American involvement in the Syrian Civil War (starting in 2009). Not only did we not end the war, but we created an even larger rift in the country, created a void that ISIS was able to fill, and oh, by the way, the war is still going on.

Long story short, international intervention is not always the best answer when it comes to a Civil War.

The international intervention are bodies that advocates for states to have an obligation to protect their inhabitants from human rights abuses such as war crimes

The international intervention can help alter the course of civil wars by:

Helping to terminate the civil by providing a third party capable of enforcing a peace treaty through reassuring military groups that need to disarm.

Extending the civil wars through shifting the distribution of power among contending factions in the civil war.

Read more about international intervention

brainly.com/question/9565844

Which phrase best explains why the items listed below, which began in the
United States, are now also popular in Japan?
• Baseball
• Blue jeans
O
Hip-hop music
O A. Cultural resistance
B. Protection of local culture
O C. Cultural diffusion
O D. Cultural divergence

Answers

Answer:

cultural diffusion

Explanation:

how did travis barker and kourtney kardashian meet

Answers

Answer:

Barker and Kardashian have been friends for years, after initially meeting in 2006 when he was dating Paris Hilton and Kim Kardashian was working as her assistant. In 2017, Barker moved into the same gated community in Calabasas as Kardashian, and the two bonded over their children.

Explanation:

....


5. The _____ is head of the executive branch of state government.
I

Answers

Answer:

The president is the head of the executive branch

The Caspian Sea is
northeast of the Red Sea.
True or False

Answers

The Caspian Sea is northeast of the Red Sea.[tex]\boxed{\sf{false}}[/tex]

Enslaved African Americans in the northern colonies enjoyed
than those in the southern colonies.

Answers

Answer: Most Northern slaves usually worked in small groups as farmhands, servants, craftsmen, and general laborers. What was different about slavery in the north, was that slaves did not live in concentrated surroundings like the plantations of the south nor was the northern economy dependent upon slavery.

Explanation: I do hope this helps!

which of these is an example of government corruption A. contracting B. Cronyism C. Tax revenue D. All of the above are correct

Answers

Answer:

D po (all of the above are correct)

who was the ideal city to plato​

Answers

Answer:

acording to plato, the ideal city had to be enlightened.

(source)

https://scott.london/articles/idealcity.html#:~:text=According%20to%20Plato%2C%20the%20ideal,fit%20to%20rule%20the%20city.

its in the story! very intresting read i might say.

Who was the most famous American naval officer who was in the war for indepence

Answers

Answer:

John Paul Jones

Explanation:

Like most members of Congress who hope to keep their seats, Senator Treumann wants to do what his best for his constituency. Sometimes, however, he thinks that what is best is not necessarily what surveys show that most voters in his state want. He sees his vote against allowing more spending on surveillance for antiterrorism efforts in this light, thinking it best for the country and his state, no matter how popular. In this case, he would be serving as the classic ___________type of legislator.

Answers

Answer:

majority and minority leaders

The Carolina colony was originally settled by:

Answers

planters from barbados

hope this helped:))

Answer:

planters from Barbados

Explanation:

How might this poem have influenced other Spaniards to join the war against the war against the British?

Answers

Answer:

KASEE

Explanation:

Poets and poetry have played a considerable part in the Spanish War, because to many people the struggle of the Republicans has seemed a struggle for the conditions without which the writing and reading of poetry are almost impossible in modern society.

A number of British writers made the Spanish cause their own (which meant, overwhelmingly, the Republican cause). Many went to Spain to support the Republicans in various roles and wrote about their experience, making it a distinctive episode in British literary history.

HELP ASAP

3. How did race and racism affect nativists' efforts to limit new immigration?

Answers

Answer:

immigrant feelings among the population, this study reveals that a racial nativism has arisen which intertwines a new American racism with tradit

Explanation:

what islamic cultural characteristics were spread by trade during the medieval times

Answers

Answer:

In medieval times, Islamic religion and culture spread mainly through military conquest and trade. With the spread of Islamic culture in the medieval times, the characteristic which were spread by trade was art and architecture. How did Muslim scholars help to preserve Greek ideas?

Explanation:

Other Questions
Solve for b.Help pls thank u !!!! Lin is paid $86 for 4 hours of work how much would she be paid at this rate for 9 hours of work? A chess club 20 with members is electing a new president. Lashonda received 8 votes. What percentage of the club members voted for Lashonda? 0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts?