f(x) = x2 – 7x- 9
g(x) = -5x – 11
Find: (g•f)(x)

F(x) = X2 7x- 9g(x) = -5x 11Find: (gf)(x)

Answers

Answer 1

Answer:

[tex](gof)(x) = -5 {x}^{2} + 35x + 34[/tex]

Step-by-step explanation:

[tex](gof)(x) = g(f(x)) \\ = - 5( {x}^{2} - 7x - 9) - 11 \\ = - 5 {x}^{2} + 35x + 45 - 11 \\ = - 5 {x}^{2} + 35x + 34[/tex]

I hope I helped you^_^


Related Questions

Write the equation of a line perpendicular to 5x−9y=−8 that passes through the point ​(−5​,8​).

Answers

Answer:  y = -(9/5)x - 1

Step-by-step explanation:

Rewrite the equation in standard form:  y = (5/9)x+(8/9).  [y=mx+b]

A line perpendicular to this would have a slope that is the negative inverse of the original slope (5/9), which would make it -(9/5).  The y-intercept would also change, but we don't know the value, yet.  For now, we'll use "b" for the y-intercept.  This results in a perpendicular line:

y = -(9/5)x + b

We can calculate b, the y-intercept, by using the point (-5,8) and solving for b.

8 = -(9/5)*(-5) + b

8 = (9) + b

b = -1

The line perpendicular to 5x−9y=−8 that passes through the point ​(−5​,8​) is

y = -(9/5)x - 1

Can someone help me do this

Answers

Step-by-step explanation:

You just add the 6cm and 86 celsius and the answer of 6cm and 86 celsius and you can multiply the 32 celsius and what is the answer is that the answer

HOPE CAM HELP

Pa rate nalng pa heart nalng dn

What square root does 120 lie between

Answers

Answer:

I think its 10 and ethier 11 or 12

120 lies between 11 and 10

Can u guys help me with #5 and 6 please?

Answers

Hope this works!
Jjgvxdhgkhxsggvxsouyvuvy

The Lopez family is driving to the state fair. First, they drove 32 kilometers to stop for a snack. Then, they drove another 35 kilometers and stop for gas. There were 17 kilometers left to drive.

How many kilometers does the family have to drive to get to the state fair?

Answers

32 kilometers + 35 kilometers + 17 kilometers

= 67 kilometers + 17 kilometers

= 84 kilometers

#LearnWithEXO

Answer:

84 kilometers

I hope it will help you po

help plzz ill gve brailiest

Answers

Answer:

The 2nd answer is the correct

Step-by-step explanation:

Hope this helps:)

What is the equation of the line that passes through the point (-7, 2) and has a
slope of -1?

Answers

Answer:

y = -x- 5

Step-by-step explanation:

[tex]y-y_{1} =m(x-x_{1} )[/tex]

[tex]y-2=-1(x-(-7))[/tex]

[tex]y-2=-(x+7)[/tex]

[tex]y=-x-7+2[/tex]

[tex]y=-x-5[/tex]

I hope this help you

The speed of light is 299 792 458 m / s


Which decadic units can you round to so that only one non-zero digit is produced?

Answers

Answer:

299,792,460

Step-by-step explanation:

just round to the nearest 10th

Answer:

The speed of light is exactly 299,792,458 m/s because that is how a meter is defined. A meter is defined as the distance light travels in 1/299792458 seconds in vacuum. Why was this particular number chosen? To keep the definition of meter consistent with the old standard which was an actual physical bar. The length of this bar was arbitrary though.

Step-by-step explanation:

Your welcome :)

Evaluate the following integral:​

Answers

[tex]\large\underline{\sf{Solution-}}[/tex]

Given integral is

[tex]\rm :\longmapsto\:\displaystyle\int\rm \frac{ {x}^{e - 1} + {e}^{x - 1} }{ {x}^{e} + {e}^{x} } \: dx[/tex]

To evaluate this integral, we use Method of Substitution.

So, Substitute

[tex]\rm :\longmapsto\: {x}^{e} + {e}^{x} = y[/tex]

[tex]\rm :\longmapsto\: \dfrac{d}{dx}({x}^{e} + {e}^{x}) = \dfrac{d}{dx}y[/tex]

[tex]\rm :\longmapsto\: {ex}^{e - 1} + {e}^{x} = \dfrac{dy}{dx}[/tex]

[tex]\rm :\longmapsto\:e( {x}^{e - 1} + {e}^{x - 1}) = \dfrac{dy}{dx}[/tex]

[tex]\rm :\longmapsto\:({x}^{e - 1} + {e}^{x - 1})dx = \dfrac{dy}{e}[/tex]

So, on substituting all these values in above integral, we get

[tex]\rm \:  =  \: \displaystyle\int\rm \frac{dy}{e \: y} [/tex]

[tex]\rm \:  =  \:\dfrac{1}{e} \displaystyle\int\rm \frac{dy}{ y} [/tex]

[tex]\rm \:  =  \:\dfrac{1}{e}log |y| + c[/tex]

[tex]\rm \:  =  \:\dfrac{1}{e}log \bigg| {x}^{e} + {e}^{x} \bigg| + c[/tex]

Hence,

[tex]\rm :\longmapsto\:\boxed{\tt{ \displaystyle\int\rm \frac{ {x}^{e - 1} + {e}^{x - 1} }{ {x}^{e} + {e}^{x} } \: dx = \frac{1}{e}log \bigg| {x}^{e} + {e}^{x}\bigg| + c}}[/tex]

▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬

LEARN MORE :-

[tex]\begin{gathered}\begin{gathered}\boxed{\begin{array}{c|c} \bf f(x) & \bf \displaystyle \int \rm \:f(x) \: dx\\ \\ \frac{\qquad \qquad}{} & \frac{\qquad \qquad}{} \\ \sf k & \sf kx + c \\ \\ \sf sinx & \sf - \: cosx+ c \\ \\ \sf cosx & \sf \: sinx + c\\ \\ \sf {sec}^{2} x & \sf tanx + c\\ \\ \sf {cosec}^{2}x & \sf - cotx+ c \\ \\ \sf secx \: tanx & \sf secx + c\\ \\ \sf cosecx \: cotx& \sf - \: cosecx + c\\ \\ \sf tanx & \sf logsecx + c\\ \\ \sf \dfrac{1}{x} & \sf logx+ c\\ \\ \sf {e}^{x} & \sf {e}^{x} + c\end{array}} \\ \end{gathered}\end{gathered}[/tex]

ADD
3xyz + 7xyz + 9xyz

Answers

Answer:

19xyz

Step-by-step explanation:

First, let us just forget about the xyz at the end of each number. Now, we just have the simple addition problem 3 + 7 + 9. First. let us do 3 + 7, which gives us 10. Now, let us take our 10 and add the 9 to it. 10 + 9 is 19. Now, we can add our xyz back to the equation. Now, we have 19xyz. As we do not know anything about what x, y, or z equals, nothing further can be done with this equation. Therefore, the answer is 19xyz.

Hope this helps! :D

Answer: 19xyz

Step-by-step explanation:

I literally just learned this right now bc i'm in school

Select all the correct answers. Which equations have a greater unit rate than the rate represented in the table? ​

Answers

Answer:

A. 5/7 x

D. 7/9x

Step-by-step explanation:

I hope this helped ♡ sorry if im wrong

How do you do this i totaly forgot.

Answers

Step-by-step explanation:

7^2+8^2=113

Then square root 113 which is 10.63 to 2.d.p

So x=10.63

I need help pleaseee

Answers

Answer:

18 cards

Step-by-step explanation:

TO solve subtract:

130-4= 126

Then divide:

126/7 =18

Check your work:

18*7= 126

126+4= 130

Hope this helps!

help me asap I have 5min to send it in​ plss

Answers

Answer

A) Morning: 2:45am. / afternoon: 2:45pm

B) Morning: 6:05am / afternoon: 6:05pm

c) Morning: 9:15am. / afternoon: 9:15pm

d) Morning: 11:35am. / afternoon: 11:35pm

Step-by-step explanation:

the original equation is this:
f(x)= x squared - 5x + 8

what value(s) of x results in f(x) = 8?

i will mark the correct answer brainliest!!

Answers

Answer:

x=0, x=5

Step-by-step explanation:

x²-5x+8=8

x²-5x=0

x(x-5)=0

x=0 , x-5=0

x=5

50 points answer now

Answers

Answer:  x3+y3+z3=k

Step-by-step explanation:

x3+y3+z3=k                                    

You're welcome mr/ms

A water park has pools, slides, and rides that, in total, make use of 8.7\times 10^{6}8.7×10 6 gallons of water. They plan to add a ride that would make use of an additional 4.8\times 10^{3}4.8×10 3 gallons of water. Use scientific notation to express the total gallons of water made use of in the park after the new ride is installed.

Answers

Answer:

as i said i would go with 93-51=42

Step-by-step explanation:

8.7*10.6=92.22 and 8.7*10+6=93

4.8*10.3=49.44 and 4.8*10+3=51

so i am thinking that you would add 93+51 which equals 144...

or you could try 93*51 but your gunna get 4,743

or try 93-51 which is 42

or try 93 diveded by 51 which is 1.8235294117647058

I would go with 93-51=42!

hope this helped:)

After the new attraction is constructed, the park will have used 8704.8 × 10³ total gallons of water.

What is Algebra?

Algebra is the study of mathematical symbols, while logic is the manipulation of those signifiers.

Parenthesis, Exponent, Multiplication, Division, Addition, and Subtraction is referred to as the PEMDAS principle. To answer the problem properly and accurately, this rule must be followed.

A water park uses 8.7 × 10⁶ gallons of water in total for its pools, slides, and attractions. They intend to include a ride that will use an extra 4.8 × 10³ gallons of water.

After the new attraction is constructed, the park will have used the total gallons of water is given as,

⇒ 8.7 × 10⁶ + 4.8 × 10³

⇒ 8700 × 10³ + 4.8 × 10³

⇒ 8704.8 × 10³

After the new attraction is constructed, the park will have used 8704.8 × 10³ total gallons of water.

More about the Algebra link is given below.

https://brainly.com/question/953809

#SPJ5

Find the equation of the line through the point ( 3 , − 7 ) that is perpendicular to the line with equation y = x − 12 .

Answers

Answer:  y = -x - 4

Step-by-step explanation:

A perpendicular line has a slope that is the negative inverse of the reference line, which is y = x-12.  The slope here is 1, so the negative inverse would be -1/1, or -1.  The perpendicular line would therefore be:

y = -1x + b

We can find b by using the given point (3,-7) as a solution:

y = -1x + b

-7 = -1*3 + b

b = - 4

The equation is therefore   y = -x - 4

c
4
− 1
= 5
HELPP!!!

Answers

Answer:

C=3/2

Step-by-step explanation:

C4-1=5

Add 1 onto both sides

C4=6

Divide each side by 4

C=6/4

Simplify (Divide by 2)

C=3/2

A group of 25 students were asked to share their favorite Ice-cream flavor. The results are shown below:
Flavor
Number of Students
Vanilla
7
Chocolate
6
Butter Pecan
5
Strawberry
4
Chocolate Chip 3
Which dot plot matches the data set?

Answers

Answer:

first 7 then 3  5  4  6

Step-by-step explanation:hope it helps

find the perimeter of the shape below if x=3 and y=10

Answers

Answer:

the same time as a great day happy independence day


Michaela gets paid $12.45 per hour. If she works 5.5. hours, how much will she earn?

Answers

Answer:

68.48

Step-by-step explanation:

12.45*5.5=68.48

can anyone help me with this problem with a full explanation?? thank you ​

Answers

Answer:

15, 16, 17

Step-by-step explanation:

let the consecutive numbers be n , n + 1 , n+ 2 , then

n + n + 2 = 32 ( sum of first and third )

2n + 2 = 32 ( subtract 2 from both sides )

2n = 30 ( divide both sides by 2 )

n = 15

n + 1 = 15 + 1 = 16

n + 2 = 15 + 2 = 17

The 3 numbers are 15, 16, 17

Step-by-step explanation:

let the 1st and 2nd consecutive number be

x , x + 1 , x + 2

their sum = 32

so, x + x + 2 = 32

2x + 2 = 32

2x = 32 - 2 = 30

x = 30/2 = 15

so,

1st and 3rd consecutive number is

x = 15

x + 2 = 15 + 2 = 17

as they are consecutive number so 2nd number is 16

and a/q sum of 1st and 3rd number is 32

15 + 17 = 32

hope this answer helps you dear...take care and may u have a great day ahead!

The sum of 2 numbers is 54. Their difference is 116. What are the numbers?

Answers

Answer:

Step-by-step explanation:

first, let the numbers be x and y.

so by question we have,

x+y=54.......(I)

x-y=116......(I I)

now, solve it through elimination method,

x+y=54

x-y=116

here, y and y cancelled out and we get,

or, x+x=54+116

or, 2x=170

or, x=170/2

therefore, x=85

now put value of x in any equation. let's put in eqn (I), we get,

or, x+y=54

or,85+y=54

or, y=54-85

so, y= -31

therefore, the numbers are 85 and - 31.

Describe the transformation of y=-2/x

Answers

Answer:

This transformation is known as a vertical stretch. This is the graph of a transformation of \begin{align*}y=x^2\end{align*}. The points are plotted from the vertex as right and left one and down one-half, right and left 2 and down two, right and left three and down four and one-half

The size of a white tablet is 0.000005 m and that of a red tablet is 0.0000275 m.Find their ratios and Compare their sizes

Answers

A ratio will just be trying to find whole number versions of these decimals and then compare them side by side (always divide the larger number by the smaller number).

Therefore:

[tex]\frac{0.0000275}{0.000005}=5.5=\frac{5.5}{1}[/tex]

However, this isn't a proper ratio. Generally, ratios are whole numbers. Since it's 5.5, we can easily make this a whole number by multiplying it by 2. Keep in mind though, what we do to one number we do to the other! So:

[tex]\frac{2}{2}(\frac{5.5}{1})=\frac{2*5.5}{2*1}=\frac{11}{2}[/tex], technically this is a better format since it's whole numbers, but it gives you the ratio (11:2) which is a bit tougher to interpret than (5.5:1)

Therefore, the ratio we'll use is 5.5:1 for simplicity's sake:

From this ratio, we can see that the red tablet is 5.5x the size of the white tablet.

Hope this helps! :)

Jose needs 6.2 lb of organic blueberries to make smoothies. Organic blueberries are on sale for $2.85 per pound. Jose estimates that he will need $12 to buy the 6.2 lb of blueberries. What is Jose’s error?

1. Jose did not make an error. His estimate of $12 is correct.
2. Jose incorrectly rounded $2.85 down to $2. The estimate should be $18.
3. Jose incorrectly rounded 6.2 up to 7.
4. Jose incorrectly multiplied 2 and 7. The estimate should be $14.

Answers

Answer: Jose incorrectly rounded $2.85 down to $2. The estimate should $18.

Step-by-step explanation:

lol i had this question

Please help. Subtract using the number line.

​ −3/5 − (−2/5) ​

Select the location on the number line to plot the difference.

Answers

Answer:

[tex]-\frac{1}{5}[/tex]

Step-by-step explanation:

→ Remember what 2 minuses make

plus

→ Rewrite the question

[tex]-\frac{3}{5} +\frac{2}{5}[/tex]

→ Solve

[tex]-\frac{1}{5}[/tex]

Answer:

Other persons brainliest

Step-by-step explanation:

Point H, with coordinates (-2,6), is part of a
figure that is transformed by dilation with a
scale factor 2. What are the coordinates of H'
after the dilation?

Answers

Step-by-step explanation:

your teacher forgot to mention if the dilation is based on the origin (0, 0).

I assume this is what was meant, but it has to be explicitly specified to be sure.

but if things are as assumed, then the scaling factor is just multiplied into the point coordinates to get the result :

H' = (-2×2, 6×2) = (-4, 12)

F = 9/5 + 32 PLS ANSWER THIS

Answers

Answer: I think it's 32.8

Step-by-step explanation:

Other Questions
Lin is paid $86 for 4 hours of work how much would she be paid at this rate for 9 hours of work? A chess club 20 with members is electing a new president. Lashonda received 8 votes. What percentage of the club members voted for Lashonda? 0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts? Job order costing can be applied or used at the same time witha. actual costing systemb. normal costing systemc. both a and bd. none of the above