english 2 hhhhheehllllllppp

English 2 Hhhhheehllllllppp

Answers

Answer 1

Answer:

adds drama

Step-by-step explanation:

it talks about dramas

Answer 2

Answer:

a

Step-by-step explanation:

it adds drama


Related Questions

can u please help me

Answers

The correct answer should be 50 feet per side. I hope this helped you.

Here are some temperatures. Edinburgh -5 °C Exeter 3 °C Manchester -2 °C a) Which place is the coldest? b) Give the difference in temperature between Exeter and Manchester. °C The temperature in Edinburgh falls by 2°C. c) What is the new temperature in Edinburgh? °C ​

Answers

Answer:A)Edinburgh B)5 degrees celsius C)-7

Step-by-step explanation:

Answer:

a) Edinburgh is the coldest

b)the difference in temperature between Exeter and Manchester is 5°C

c)-5+-2=-7         the new temperature in Edinburgh is -7

Step-by-step explanation:

Edinburgh -5 °C

Exeter 3 °C

Manchester -2 °C

I need Help with one and two ..?

Answers

1: 1/6561

2: 243
I hope this helps!

Select from the drop-down menus to correctly complete the statements about the expression a8+6b .
The expression a8+6b is a
A. Sum
B. Difference
. The term a8 is an added, but it is also a
A. quotient
B. Difference
. The term 6b is an added, but it is also a
A. Sum
B. Product

Answers

Expressions are used to show relationships between variables and constants

The expression [tex]\mathbf{\frac a8 + 6b}[/tex] is a sumThe term [tex]\mathbf{\frac a8}[/tex] is a quotientThe term 6b is a product.

The expression is given as:

[tex]\mathbf{\frac a8 + 6b}[/tex]

In the above expression, a/8 and 6b are added.

So, the expression [tex]\mathbf{\frac a8 + 6b}[/tex] is a sum

In [tex]\mathbf{\frac a8 }[/tex], a is divided by 8.

So, the term [tex]\mathbf{\frac a8}[/tex] is a quotient

Lastly, in 6b; 6 is multiplied by b.

So, the term 6b is a product.

Read more about expressions at:

https://brainly.com/question/22151679

what is the greatest common factor of 22 and 121​

Answers

Answer:

11

Step-by-step explanation:

In 20 seconds, a roller coaster goes up a 100-meter hill, then down 72 meters, and then back up a 48-meter rise. What integer represents the vertical change from the start of the ride for the coaster after the 20 seconds?

Answers

The question is an illustration of arithmetic operations.

The integer that represents the vertical rise is 76

Upward movements are represented with positive, while downward movements are represented with negative.

So, the given parameters are:

[tex]Up = 100m[/tex]

[tex]Down = -72m[/tex]

[tex]Up= 48m[/tex]

The vertical rise is:

[tex]Rise = Up_1 + Down + Up_2[/tex]

So, we have:

[tex]Rise = 100m -72m +48m[/tex]

[tex]Rise = 76m[/tex]

Hence, the integer that represents the vertical rise is 76

Read more about arithmetic operations at:

https://brainly.com/question/15385899

what is 1760 rounded to the nearest hundred

Answers

Answer:

1800

Step-by-step explanation:

2a-3b for a= 1/2 and b =6

Answers

Answer:

- 17

Step-by-step explanation:

Substitute the given values into the expression

2a - 3b

= 2 × [tex]\frac{1}{2}[/tex] - 3 × 6

= 1 - 18

= - 17

Write an algebraic expression into words 9m-3

Answers

Answer:

subtract 3 from the product of 9 and m

reduce each fraction by its lowest term 6/10

Answers

Answer:

2/5

Step-by-step explanation:

6/10 simplified to 2/5

Please make me brainleist i need to level up

you have 89 apples in you car your teacher wants 46 of them how many do you have lefy?​

Answers

Answer:

43

Step 89-46=43

Answer:

43 apples

Step-by-step explanation:

89-46=43

If you need to check you could do the opposite:

46+43=89

Since that checks out you know the answer would be 43.

Please help, I’ll give Brainly

Answers

Answer:

the answer should be the third one

Step-by-step explanation:

It’s C! A> 5/3! Hope this helped

how do I write
[tex] \frac{7}{8} [/tex]
as a mixed number decimal? ​

Answers

Answer:

0.875

By dividing them

Hope it helps

Answer:

0.875

Step-by-step explanation:

[tex]\frac{7}{8} \times \frac{125}{125} =\frac{875}{1000} =0.875[/tex]

please help me quickly

no random links i will report :)

Answers

The answer should be D. I hope this helps and could I get brainliest please?!

(4x+2)=102+44 solve for x

Answers

Solution:(4x + 2) = 102 + 44or, 4x = 102 + 44 - 2or, 4x = 144or, x = 144 ÷ 4or, x = 36Answer:

x = 36

4x + 2 = 102 +44
4x+2 = 146
(4x+2) + (-2) = 146 + (-2)
x=36

-4d > 8 and 2d > -6 and graph

Answers

Answer:

Step-by-step explanation:

We can add like terms. Like terms are when the variables are alike, so you can add them to get a simpler form of your expression.equation.

4d and 2d are like terms, therefore, we can add them.

6d+6 is what we are left with.

Our final answer: 6d+6 is equivalent to 4d+6+2d

Answer:

Step-by-step explanation:

3.7 - 1.8 - 3.67 + 4.4 - 1.34

Answers

Answer:

1.29

Step-by-step explanation:

Your answer is : 1.29

WILL GIVE BRAINLIEST

When you draw one marble from a bag, and don't put it back into the bag for the second draw, what kind of probability is it?

Answers

Answer:

it is a dependant event without placement

Step-by-step explanation:

you dont replace the marble so it is dependant. and without replacement is when you dont put it back in the bag

help please i need it

Answers

London, it’s asking for standard time area closest to GMT

identify whether each if the following represents a quadratic function or not put yes or no
1. y = x² + 2
2. y = 2x - 10
3. y= 9 - 2x²
4. y = 2x + 2
5. y = 3x² + x² + 2​

Answers

9514 1404 393

Answer:

yesnoyesnoyes

Step-by-step explanation:

The function is quadratic if the highest degree of any term is 2. Equations 2 and 4 have degree 1, so are linear (not quadratic) functions. Equations 1, 3, and 5 have terms of degree 2 (at most), so are quadratic functions.

_____

We assume that two terms of degree 2 in equation 5 is intentional. If one of those is supposed to be of degree 3 (or more), then that function is not quadratic.

can someone pls tell me what 3/7 times negative 9/5

Answers

Answer:

-27/35, and the decimal answer -0.77142857142

Step-by-step explanation:

multiply the fractions- 3 x 9 equals 27, 7 x 5 equals 35. The answer is negative.

19 , -23 across the x axis

Answers

Answer:

correct

Step-by-step explanation:

Solve for x.

x−1.2=3

Answers

Hello!

Answer:

x=4.2

Step-by-step explanation:

first, you want to add 1.2 to both sides

x-1.2+1.2=3+1.2

=x=4.2

= x=4.2 :)

Hope this helps!

anybody help? reporting fake answers tysm!!

Answers

Answer:

2-----10

1-----5

3-----15

Step-by-step explanation:

For every 1 cup of blue paint, there are 5 cups of yellow paint

Hope this helps!

solve for k.
k(4r−5)≥12r−9

Answers

Answer:

[tex]k = \frac{12r - 9}{4r - 5} \\ [/tex]

Step-by-step explanation:

[tex]k(4r - 5) \geqslant 12r - 9 \\ k = \frac{12r - 9}{4r - 5} \\ [/tex]

A landfill has 30,000 tons of waste in it. Each month it accumulates an average of 585 more tons of waste. Let m represent the number of months.

What is a function that represents the total amount of waste after m months?

Answers

Answer:

f(m) = 585m + 30, 000

Step-by-step explanation:

First you need to set up your variable which is m which makes f(m) and since each month gives 585 tons per month we have the variable attached to that (585m). However, we already start with 30,000 so we add that in. You can check the answer by replacing m with a number, which for me I will choose 10, which gives me 35,850 which makes sense.

in a class of 25 students 15 of them have a cat 16 have a dog and 3 of them have neither find the probability that a student at random has a cat and a dog

Answers

Answer:

Step-by-step explanation:

7 students have cats only

6 students have dogs only

9 students have dogs and cats

3 students don't have cats or dogs

+ -----------------------------------------------------

25 students in total

Help !! Multiply: 2w(w+17)

Answers

Answer:

2w^2 + 34w

Step-by-step explanation:

2w(w+17)

Multiply the 2w by each term in the parentheses

2w*w + 2w*17

2w^2 + 34w

Find the Distance rounded to a whole number.
Give the distance between (2,1) and (5,2)

Answers

Answer:

[tex]\sqrt{10}[/tex]

Step-by-step explanation:

The distance between two points can be found using the Pythagorean Theorem [tex]a^{2} + b^{2} = c^{2}[/tex].

This is because, if you connected your two points with a line, that line could be defined as the hypotenuse of a right triangle. the base of that triange is the distance between the x coordinates ([tex]x_{2} -x_{1}[/tex]) and the height by the distance between the y coordinates ([tex]y_{2} - y_{1}[/tex]). Sine these are the sides of the right triangle, they are equal to a and b above (c is the hypotenuse that we are trying to find). So, we calculate the two distances above and get 3 and 1 (for x and y respectively). 3^2 + 1^ 2 =10. So the answer is square root 10.

What does negative 2 over 3 > −1 indicate about the positions of negative 2 over 3 and −1 on the number line? (4 points) Group of answer choices negative 2 over 3 is located to the right of −1 negative 2 over 3 is located on the left of −1 negative 2 over 3 is located on the right of 0, and −1 is located on the left of 0 negative 2 over 3 is located on the left of 0, and −1 is located on the right of 0

Answers

Answer:

negative 2 over 3 is located to the right of -1

Step-by-step explanation:

-1 is further to the left than negative 2/3.  Negative 2/3 is closer to 0.

Negative 2/3 is between -1 and 0.

These statements eliminate the other possible answers.

Other Questions
Mai, goran, and Juan have a total of $84 in their wallets. Goran has 3 times what Juan has. Mai has $6 less than Juan. How much does each have? June follows a special diet that does not allow her to eat any milk products. This diet could be __________.A.vegan, lactose-free, or diabeticB.lactose-free, vegan, or ovo-vegetarianC.kosher, lactose-free, or low-sodiumD.diabetic, lacto-vegetarian, or low-sodium Solve for b.Help pls thank u !!!! Lin is paid $86 for 4 hours of work how much would she be paid at this rate for 9 hours of work? A chess club 20 with members is electing a new president. Lashonda received 8 votes. What percentage of the club members voted for Lashonda? 0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14?