1. Kelly Sly has given this story to her editor, who finds new mistakes—seven to be precise!
2. Can you find them all? Write the change on the lines below.
3. The capitalization, usage, punctuation, spelling, and sentence structure are correct. You need to change the
ideas in the story [revise).
you wi...
I visited the harbor on Saturday, September 31. I was after a gang of smugglers operating out of a
four-engine sailboat docked at pier 3. A quick view of the vessel showed the anchor safely pulled up. I
walked up the gangplank onto the deck and looked for somewhere to hide. A barrel full of ropes seemed
ideal, so I climbed in and waited. It wasn't long before some men appeared. "We share the loot three
ways, like we always do," said one. The others nodded sullenly. Unfortunately, I chose that moment to
Sneeze. They were onto me immediately, dragging me from the tight funnel. "A spy! Throw her
overboard!" cried the one with the black long-sleeved shirt and the tattoos on his back. "Look behind
you!" I screamed, and as they turned, I dove into the murky river. Unfortunately, the smugglers spotted
me and finished me with a fatal shot.
1
2.

Answers

Answer 1

Answer:

Explanation:

The capitalization, usage, punctuation, spelling, and sentence structure are correct. You need to change the ideas in the story (revise).


Related Questions

In this excerpt the harps music is a symbol of odesseuss

Answers

Answer:

Odysseus's Reaching the gate,

Explanation:

In this excerpt, the harp's music is a symbol of Odysseus's Reaching the gate, Odysseus and the forester halted and stood outside, for harp notes came around them rippling on the air as Phemios picked out a song. Odysseus caught his companion's arm and said: "My friend, here is the beautiful place -who could mistake it?

Answer:

What is the symbolism of the new cloak in this excerpt? The new cloak represents Odysseus's transformation from a weary traveler to the returning hero. Jackson is making predictions about The Odyssey as he reads this excerpt.

Explanation:

3 pages
you are the narrator
you are a ghost - do NOT choose a real person that you know
your story can be funny or silly if you'd like
you witness a crime
describe exactly what you observe
Describe in detail - who you are, what happened to you, how you died, and how you became a ghost
Describe some supernatural ability that you possess
Describe how you use it for good

Answers

My story

   In the evening,me and my friends decided to go to the cinema. It was a wonderful day , but it was raining. Unfortunately it was super foggy outside , i basically died in a car crash .

Hello , my name is ____________ And Im a ghost,and before i died i couldve see my future,as a ghost! Okay, so im not a normal ghost. Im a magic ghost with the power of stopping the time!

Thats soo cool right? You may ask, how is that power useful? Oh well,when a thief tries to steals a old lady's bag,i stop the time and give the bag , back to the lady. I also stop the time in serious moments,when a person almost gets hit by car,i stop the time and then..BOOM! Everyone is alright,haha im such a hero right? Well that was my story .

Im sorry thats all,Its more like an idea so you can get more ideas .I know Its not a lot because im in a rush .

1. I ——————— at a bank. A. work B. works C. working

Answers

a) work

I work at a bank

Which quote supports the theme of neglect?A.“A certain troublesome block of building thrust forward its gable onthe street.”B.“It was two stories high; showed no window, nothing but a door onthe lower story.”C.“Tramps slouched in the doorway and struck matches on the panels;children kept shop upon the steps.”D.“For close on a generation, no one had appeared to drive away theserandom visitors or to repair their ravages.”

Answers

Answer:

ghbg

ghExplanation:

jgjh

Answer for a friend please? Thank you.

Answers

Answer:

The answer is A

Explanation:

Hope this helps!

Answer:

I think it's A because in the first example, the person isn't pressured into traveling to Mexico to learn about their family's history, while the other ones have some sort of pressure/reward.

Explanation:

^

Hope that helped! Can I also get brainliest? I need a few more to advance, if not thank you anyways and have a nice day!!!

Paragraph on act 5 scene 5 Macbeth

Answers

Answer:

BRAINLY PLS

Explanation:

A woman's cry is heard, and Seyton appears to tell Macbeth that the queen is dead. ... Enraged and terrified, Macbeth recalls the prophecy that said he could not die till Birnam Wood moved to Dunsinane. Resignedly, he declares that he is tired of the sun and that at least he will die fighting.

heres another summary

Macbeth's soliloquy in Act 5 Scene 5 after hearing about Lady Macbeth's death acts as a reinstitution of Macbeth's trace of humanity, he reflects upon his own actions and life itself. Macbeth's melancholy lamentation over Lady Macbeth's death reveals the disorientation of time caused by his actions.

a. Does your brother need a babysitter when your parents go out? No, She…………… (look after)

Answers

The best way to complete the given sentence is to add the phrase:

Would be well looked after

According to the given sentence, we can see that there is a dialogue between two people about the welfare of a child and the possibility of getting a babysitter.

As a result of this, the best way to complete the sentence would be to add that the baby brother would be well looked after.

This is because, the second speaker already disagreed with the idea of a babysitter and stated that her brother would  be well looked after.

Therefore, the best answer would be "Would be well looked after"

Read more about dialogue here:

https://brainly.com/question/24787390

Answer the following conditional questions with the correct structure the first conditional

Questions:
1. What will you do if you win the Quiz Bee?
2. What will you do if you break up with ur friend?
3.If you want to relax after class, what will you watch?
4. If you have some free time on Saturday, will u study more?
5. What will u do if u get your expected grades?

Answers

1.) What will you do if you win the Quiz Bee?

Answer: Enjoy the day with your family or friends, celebrate with them in the restaurant's, mall, park, etc.

2.) What will you do if you break up with ur friend?

Answer: Acknowledge your pain. First, know that your grief is normal. The pain from a breakup of a deep friendship is as real and valid as any other. You and your friend probably shared almost everything and spent practically all your time together. You talked on the phone for hours on end, and shared endless texts and messages. And now it’s all gone. That loss of intimacy and connection is real. It’s valid. And it hurts: please don’t try to tell yourself it’s nothing, because it really is something.

3.) If you want to relax after class, what will you watch?

Answer: You can watch some Historical TV shows, Netflix, Kdrama, etc.

4.) If you have some free time on Saturday, will u study more?

Answer: Why not, If you have much time to study or do your school work's do it. If you have time to study do it because it can give you more information if you don't know the question(s).

5.) What will u do if u get your expected grades?

I don't know what you mean by expected but i guess its bad and good grade.

Answer:

Bad grade

I will tell it to my parents. I will study hard and im going to focus on my studies so i can have a good/high grades, and make my parents more proud of me.

Good grade

I'm going to tell it to my parents that i got a good grades and i will continue to focus on my studies so i can have a good grades as always.

Pls if you think my answers is wrong just change it

Stay safe!!

perspicacious means:
consecutive
ventral
lustrous
sagacious

Answers

Answer:

none

Explanation:

BRAINLIST!!!!!

THE OUTSIDERS!!!!!!

Make a “cast” sheet. Type the name of a character and his/her information to the left side of your document and find a picture of a celebrity. Copy and paste the picture to the right side of the document. Below the picture, type a message that identifies the actor/character. For example: Hulk Hogan as Darry.... Include a paragraph (4-5 sentences) on why you feel your chosen celebrity would be perfect for the role. You should select at least eight major characters.

1. Darry
2. Johnny
3. Two-Bit
4. Dally
5. Ponyboy
6.Sodapop
7. Steve
8. Cherry
9. Marcia
10. Sandy
11. Tim Shepard
12. Curly Shepard

Answers

Answer:

8. Cherry

9. Marcia

10. Sandy

11. Tim Shepard

12. Curly Shepard

Answer:

bnsiwndjsn oi

Explanation:

hskqkmskcmd

‘I punch my pillow’ - Identify the poetic device?

a. Rhyming
b. Repetition
c. Alliteration
d. Sibilance.
How many sets of rhyming words are there in the given poem?

a. 4
b. 5
c. 6
d. 7

Answers

Answer:

C. Alliteration

A. 4

Explanation:

I dunno if this is right...

What does the article state about Percy Spencer’s character? Give four details

Answers

Answer:

1. He dropped out of grammar school at age 12 to work as a spindle boy in a weaving mill.

2. In his early years he taught himself about electricity.

3. He even setting up a new electrical system at a local paper mill.

4. His parents died, the boy was sent to live with an aunt who made her living as an itinerant weaver.

Someone plz help me :(

Answers

Answer:

I think C

Explanation:

The Neolithic Revolution describes the transition from hunting and gathering to farming and then to the onset of agrarian societies. This process, which relied mainly on the domestication of wild plants and animals, occurred independently in at least seven parts of the world from 10,000 BC.

They/ ask/ a/ man/ about/ the/ way/ the/ railway/ station.

Answers

Please explain the question? Thank you

I need this asap. The topic is “science”

Answers

Organ system I think

Write down words (min. of 5 words) that can be connected to the word "communication." Once you are done, connect the words to define communication in your own words. Discuss briefly what you have written on your definition​

Answers

Answer: can you explain more

Explanation:

How will people get justice by doing a protest

Answers

Answer:

Explanation:

Protests are a catalyst for social change, and are essential for citizen participation in a pluralistic democracy. They enable individuals and groups to share their views and interests, express dissent, and make demands of the government or other institutions.

please anyone who know…….

Answers

Here is the answer— ———————————————

Which of the following describes the author’s purpose in paragraph 1? A. to share how difficult it was to celebrate mistakes B. to show how skeptical she was of celebrating mistakes C. to share an experience in which she celebrated mistakes D. to show how she teaches her students to enjoy making mistakes

Answers

Answer:

D

Explanation:

Answer:

d as you can see

Explanation:

SLA+ metrics help to highlight dependencies and mitigate

Answers

SLA+ metrics help to highlight dependencies and mitigate, therefore the statement is true.

SLA+ metrics refer to the criteria that are negotiated between a service provider and the customer that defines a quantitative target.

It should be noted that one has to monitor that the service that one provides matches what is in the service contract.

The service-level agreement simply means the level of service that one expects from a vendor that's vital in laying out the metrics through which the service is measured. It is vital in the mitigation of issues.

In conclusion, the statement is true.

Read related link on:

https://brainly.com/question/24984231

Need asap!

If Greek gods and goddesses are still present today, in what way can they help make the world peaceful in terms of contentment, love for family, truth and justice, and honor? ​

Answers

Answer:

truth and justice

Explanation:

because they still didnt leave anything to atrack our world

danny wanted to become a lawyer so that he could____for troubles teens

Answers

Answer:

accomadate

negro

Explanation:

On the first page of the excerpt (page 6), the narrator explains that the child awoke when something beneath him crashed. Considering what we learn later on, what most likely happened in the scene before this? Who is the man Jack, and why is he looking for the boy?
Study Sync The Graveyard Book

Answers

Answer:

Explanation:

The most likely explanation of what happened in the scene before is that the boy's mother was killed by the husband and in a fight to stay alive she put up a fight. This fight created the loud crashes, but sadly she lost the fight as well as her life. We can infer this because Mrs. Owens says when her figure appears in the graveyard "..Freshly dead by the look of her."

Man Jack is most likely the man that killed the mother of the boy. He is looking for the boy so that he can "eliminate" him and hide the evidence and then leave town, also leaving no evidence of a crime, doing this so he get quickly leave town, not get caught, and if he does get found out he will be far away from the crime scene and inevitably become untraceable

I hope this helps you.


Two uses of the comma are to set off

Answers

Answer:

Use a comma after an introductory clause or phrase. ...

Use commas to set off nonrestrictive clauses

What innovations or business did this entrepreneur contribute to the world?

Answers

which entrepreneur??

hi brainly after a long time

:D​

Answers

Answer:

HELLO

Explanation:

1) He was the second to (reach - arrive - get - all answers)

2) She's too short to (arrive - get - reach - all answers)​

Answers

Answer:

1. arrive

2. reach

Please help me with this question it is due tomorrow!

Answers

Answer:

what the question

Explanation:

Which is true of credit unions?
O They cannot pay interest on deposits.
O They operate as non-profit organizations.
O They do not provide traditional savings accounts.
O They provide more services than large commercial ban

Answers

Answer:

They operate as non-profit organizations.

Explanation:

they do operate as non-profit organizations.

2. Describe the practices of Confucianism.

Answers

Confucianism believes in ancestor worship and human-centered virtues for living a peaceful life.
Other Questions
Solve for b.Help pls thank u !!!! Lin is paid $86 for 4 hours of work how much would she be paid at this rate for 9 hours of work? A chess club 20 with members is electing a new president. Lashonda received 8 votes. What percentage of the club members voted for Lashonda? 0help pls!----------- Simplify this expression. Need help with math homework which king is most associated with bas-reliefs I NEED A SCIENCE EXPERT TO GIVE ME THE RIGHT ANSWER TO THESE ASAP How were the ancient civilizations established and develop? 3-5 sentences The graph of the exponential function f(x) = 4(0.5)* + 2 is shown. help me plz I don't have a time It costs $45 for a flower arrangement and $.30 per mile for delivery. If the total cost came to $49.80, how many miles were the flowers delivered?Set up an equation to solve for the number of miles driven. he curtain rises on an empty stage. It is late afternoon November, 1945. The rooms are dusty, the curtains in rags. Chairs and tables are overturned.It is early morning, July 1942. The rooms are bare, as before, but they are now clean and orderly.Read the two sets of stage directions in the passage. Then explain how you would set the stage to show that a time shift has occurred if you were the director. Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Which of the following statements about the election of 1796 are true Help please thank you so much! What percentage of citizens actually attended the Assembly? How are you supposed to graph #14? Who was the first emperor of the Tang Dynasty? You have 10 blue shirts and r red shirts.What expression shows your total number of shirts?