Answer:
A. Adrenaline
Explanation:
adrenaline is a hormone
Answer:
A. Adrenaline
Explanation:
A is NOT correct because the actual 4 chemicals in DNA are Adenine,Cytosine, Thymine and Guanine.
Adrenaline is NOT part of the 4 chemicals of the DNA, which makes A correct answer.
Which animal phylum was the first to develop a dorsal nerve cord a backbone?
Answer:
Chordates?
Explanation:
What is black soil best for?
O constructing buildings
O having a wildlife environment
O having a desert environment
O farming land
Answer:
I believe the answer is farming
Answer:
having a wildlife environment
Explanation:
I took the test and this was the correct answer so your welcome
What that determines if a cell is eukaryotic. *
Which would have a bigger effect on an organism, an error during transcription or a missense mutation? Explain in one or two sentences. (
A missense mutation will change the amino acid sequence. This may alter the function of the protein, usually negatively, but sometimes positively. This later case may be favored by evolution, as the change is heritable.
Describe the different internal and external factors that affect human health.
Answer: Biology, psychology, emotions, spirit, energy, lifestyle, culture, economic and political influences, social interactions in family, work, living area and the possibilities to expresses oneself and live full life with a sense of well-being have influence on people appearances.
Explanation:
What are the impacts of genomic era on microbial phylogeny systematics
provide a platform for current research on archaea, bacteria, microbial eukaryotes and viruses.
Human Use of Land
Journal Activity Active
Prompt
How has human land use impacted the environment?
Read More >>
Decreased water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.
How human impacted the environment?Humans impact the environment in many ways such as overpopulation, pollution, burning fossil fuels, and deforestation. Human activities triggered climate change, soil erosion, poor air quality, and undrinkable water.
So we can conclude that reduction of water quality, increased pollution, depletion of natural resources and global climate change are the results of human land use.
Learn more about environment here: https://brainly.com/question/17413226
The graph shows the change in seabird mortality rates in New Zealand waters due to illegal, unreported, and unregulated fishing (IUU) and the implementation of bycatch remediation measures in 2004. What conclusion can be made about the impact of the remediation measures that were used?
Illegal and unregulated fishing practices continue to cause increases in bird bycatch numbers, in spite of the new measures.
Legal fishing practices have caused the new remediation measures to become more effective.
The measures virtually eliminated all of the bird bycatch.
The measures used showed very little impact on the overall seabirds caught in fishing lines.
According to the graph, the measurements practically eliminated all incidental captures, as shown in the third answer option.
What does the graph show?Illegal capture practices show a high performance between 1997 and 2003.Illegal capture practices show a low performance from 2004 and this performance tends to fall in the next years until it presents very low values.Legal capture practices maintain a balanced performance.The decrease in the performance of illegal practices from 2004 onwards, shows how the remediation measures were efficient in reducing the activity of these practices and providing a better environmental well-being.
More info about graphics on the link:
https://brainly.com/question/14323743
So basically how do i ask my best friend out?
Answer:
Explain
well just do it i belive in you dont try to act all diffrent or cool that makes people not like u just be yourself
Look at the tropical grassland ecosystem.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
Picture of tropical grassland with zebras and wildebeests feeding on grasses. Giraffes are in the background, along with bush trees.
There are more zebra than the carrying capacity of the pictured ecosystem. This represents a
climax community
biological surplus
peak phenomenon
sigmoid phenomenon
Answer:
It is B Biological Surplus
Explanation:
Biological Surplus means that a species population has grown too big, above carrying capacity
What is salinity and how does it change?.
A balance between water withdrawn by evaporation and freshwater added by rivers and rain controls salinity. The Mediterranean Sea in Europe has a salinity of 38 parts per million or more. It's nearly cut off from the main ocean, and there's more evaporation than rain or additional freshwater from rivers.
At the molecular level, how do scientists know a new species has arisen?
Answer:
DNA sequencing has brought us the genetic species concept. In this model, species are defined by genetic isolation rather than reproductive isolation. Species may be more or less identical morphologically, but differences in DNA determine whether or not a population is a new species.
Explanation:
? :-)
Define nondisjunction. Is this a beneficial process? Explain.
Answer:
Nondisjunction occurs when chromosomes fail to segregate during meiosis; when this happens, gametes with an abnormal number of chromosomes are produced. The clinical significance is high: nondisjunction is the leading cause of pregnancy loss and birth defects
Explanation:
Evaluate the role of media in addressing substance abuse with special reference to the following . 1television 2.social media platforms
Social media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.
What is social media?Social media are online platforms that allows the user to create, write or display content and share with viewers and it also helps to access information and participate in many social networking.
Socal media campaigns have been done on television programs and other social media platforms to prevent the illicit use of drug by young and old people. This is because most young people visit the online platforms more and awareness and sensitization are going on to make know of the harm and danger in substance abuse.
Therefore, media help in addressing substance abuse through awareness and sensitization are going on to make know of the harm and danger in substance abuse.
Learn more on social media here,
https://brainly.com/question/3653791
T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
What is a sense DNA strand?DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
https://brainly.com/question/1048150
Answer:
C
Explanation:
At each link of the food web, approximately_________
percent of the energy is passed on to the consumer and
approximately_________
percent of the energy is lost as
heat.
Approximately 10 percent of the energy is passed on to the consumer and approximately 90 percent of the energy is lost as heat.
What is a Food web?This refers to an interconnecting diagram that shows the overall food relationships between organisms in a particular environment.
90 percent of energy is usually lost as heat thereby allowing for the transfer of only 10 percent of energy to the consumers.
Read more about Food web here https://brainly.com/question/2179
why is it beneficial for scientists to understand how other organisms are able to edit which proteins are created
Answer:
Genome editing technologies enable scientists to make changes to DNA, leading to changes in physical traits, like eye color, and disease risk
Explanation:
What material is the objective lens made of in UV fluorescence microscopy
Answer:
quartz
Explanation:
Can someone PLease help me with these questions?!
Answer:
I can't read it. It is too small
Explanation:
It is too small for me to read
What changes occur in the atmosphere as you go higher?.
Answer:
Air pressure drops, and temperatures get colder.
Explanation:
Hope this helps!!
Why is over farming a threat to the health of humans?
A.
It decreases the use of fertilizer.
B.
It increases the production of food.
C.
It adds too many new nutrients to the soil.
D.
It removes too many nutrients from the soil.
Answer:
it removes too many nutrients from the soil.
Explanation:
Explanation:
it can increas the health risk
VIDA chart for biology
Answer:
Yes you are right I didn't get the question too.
How have hominid skulls changed over time? What are some of the reasons for those
changes?
Answer:
The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.
Explanation:
Give brainlist me please
The change from the oblong skull and protruding face of ancient humans (right) to the modern rounder skull and retracted face is associated with a sharper bend in the floor of the brain case (lower left), thought to be caused by increased brain size.
Which type of rock would most likely be found near the landform shown in the picture?
Answer:
Igneous rock because it forms when hot molten rock (lava) crystallizes and solidifies .
Explanation:
Have a Nice day!! :D
Which of these is a benefit of fish farming?
A. It poses a risk of disease for wild stocks.
B. It depletes fish populations.
C. It eases the demand on commercial fisheries.
D. It pollutes natural bodies of water.
Answer:
C
Explanation:
It's pretty simple really, just find the Benefit. Pollution is definitely a harmful effect, disease is also not a benefit, and depletion of fish population is bad, so easing demand on commercial fisheries is the answer
Which compounds are not soluble in water?
answer :
All salts of : carbonate, CO3 2- phosphate , PO4 3- oxalate, C2O4 2- chromate, CrO4 2-sulfide, S 2- most metal hydroxides and oxides (OH-)
Exceptions :
Salts of NH4 +, and the alkali metal cations
Answer:
All salts of : carbonate - phosphate - oxalate, chromate,- most metal hydroxides and oxides
Explanation:
The Earth’s rotation is the only thing that impacts wind
Answer:
false
Explanation:
While the Earth's rotation does play a role, it is a somewhat indirect one. The primary factor that affects the formation of winds is differences in atmospheric pressure. As is true throughout nature, any fluid will try to move from a region of high pressure to a region of low pressure.
Answer:
False
Explanation:
This is false because the earth goes one way but the wind can go all kinds of ways
What is the great pacific trash gyre?
Answer:
The Great Pacific garbage patch (also Pacific trash vortex) is a garbage patch, a gyre of marine debris particles, in the central North Pacific Ocean. It is located roughly from 135°W to 155°W and 35°N to 42°N.
Name the five carbon sugar in a DNA neucleotide
Which object measures atmospheric pressure?
a ballast tank
a barometer
a thermometer
Answer:
A barometer
Explanation:
It is commonly used to measure atmospheric pressure