Some specifically selected hormones, cholesterol, LDL and iron enter cells via
A) exocytosis
B) endocytosis
C) pinocytosis
D) receptor-mediated endocytosis

Answers

Answer 1

Answer:

B) endocytosis

Explanation:

Endocytosis is the process through which things pass through the cell membrane and into the cell.

Endo = internal, within

Cystosis = referring to cells

Answer 2

Some specifically selected hormones, cholesterol, LDL and iron enter cells via Endpcytosis.

Thus, Some plasma-membrane proteins can be efficiently absorbed and concentrated through endocytosis linked to clathrin coating.

This method transports iron-loaded transferrin protein and cholesterol-containing LDL particles linked to these receptors into the cell, and it also internalizes the low-density lipoprotein (LDL) receptor.

By using electron microscopy, it is possible to see the characteristic basket-like structure that the clathrin coat that forms on these structures creates. It is thought that the polymerization of the clathrin coat promotes changes in membrane curvature, surface membrane deformation, and vesicle formation.

Thus, Some specifically selected hormones, cholesterol, LDL and iron enter cells via Endocytosis.

Learn more about Endocytosis, refer to the link:

https://brainly.com/question/32110020

#SPJ2


Related Questions

What’s the correct answer answer asap for brainlist
Is it C?

Answers

The way in which a neuron goes from a negative charge to positive charge is that: C. an action potential opens the gate sodium channels stay behind, and floods the cell with positive ions.

What is a neuron?

In Science, a neuron can be defined as a nerve cell that is saddled with the responsibility of transmitting electrical signal (impulses) down an axon across a cellular membrane of the body of a living organism, especially through an action potential.

Generally speaking, the neuron comprises different parts and are of different types which include the following:

Cell bodyMyelinSensory neuronDendritesMotor neuronReceptor neuronAxonAction potential

What is an action potential?

An action potential simply refers to a sudden, fast change in electrical (voltage) potential with respect to the transmission of an impulse to a receptor, across a cellular membrane such as the following:

A nerve cellA muscle cell

In conclusion, a neuron changes from a negative charge to positive charge because a resting potential neuron has a negative charge while sodium ions have a positive charge.

Read more on neurons here: brainly.com/question/13076783

#SPJ1

Distinguish between monohybrid, dihybrid and test crosses.

Answers

In the monohybrid cross, the possible offspring of a cross between two organisms is evaluated, but only one characteristic is taken into account. While in the dihybrid cross two characteristics are evaluated.

However, unlike the monohybrid cross, in the dihybrid cross, combinations of alleles must be made in order to obtain all possible gametes and thus perform the punnet square properly. An example of a dihybrid cross and allele combination is shown in the following image:

Finally, a test cross refers to these two examples. A test cross taking into account only one trait is called a monohybrid cross. A test cross using 2 traits is a dihybrid cross.

What is the genetic make-up of an organism?A) PhenotypeB) AllelesC) GenotypeD) DNA

Answers

Solution:

The genotype is the collection of genes of an individual, that is, it is the genetic information that a particular organism possesses. This means that in a broad sense, the term genotype refers to the genetic makeup of an organism.

We can conclude that the correct answer is:

C) Genotype

A scientist claims that Elysia chlorotica, a species of sea slug, is capable of photosynthesis. Which of the following observations provides the best evidence to support the claim?1) Elysia chlorotica grows in the dark when food sources are available.2) Elysia chlorotica grows faster when exposed to light than when placed in the dark.3) Elysia chlorotica will die if not exposed to light.4) Elysia chlorotica grows when exposed to light in the absence of other food sources.

Answers

The observation which best supports the claim that Elysia chlorotica is capable of photosynthesis is number 4. The ability to photosynthesize doesn't mean it won't be able to eat other food sources when abailable, but that it will be able to survive and grow in abscense of food sources if it is exposed to light, as light is necessary to obtain the energy for the process of photosyntesis.

Name and describe at least two applications for population estimates.

Answers

7.1 billion and 3.1 trillion

Which of the following molecules provides the greatest energy storage capacity in animal cells?
A. starch
B. proteins
C. triglycerides

Answers

Triglycerides are the molecules that provide the greatest energy storage capacity in animal cells.

What is triglycerides?

Triglycerides are the type of fat also called lipids that are found in your blood. When you eat, your body converts calories that it does not need to use into triglyceride molecules. The triglycerides are stored in the fat cells. After the hormones release triglycerides for energy between eating. Sugary food, sweat drinks, saturated fats, refined grains, alcohol, and foods having high-calorie all lead to high levels of triglycerides. The healthcare provider classifies high triglyceride levels i.e. Mild levels as 150-199 mg/dL, Moderate level has 200-499 mg/dL, and Severe levels has Greater than 500 mg/dL. Very high triglycerides may cause blocking of the blood supply to the heart or brain. Symptoms of lower blood supply to your heart could be chest pain.

So we can conclude that option C is the correct answer.

Learn more about energy here: https://brainly.com/question/13881533

#SPJ1

Is there any cons to the environment of living rurally ?

Answers

Living in rural environments can be difficult due to the distance from the major centers and amenities of urbanization, since the way in which the human pecies has adapted to live in a community is direct linked to technologies that are sometimes nor available in a rural region. The lack of diversity of functions can also become a hindrance, since the rural region have agricultural activities or related to agriculture as the marjor, or in some cases the only, possibility of branch of work.

To the environmental the increase in people living in a rural region is the increased comsumption and exploitation of local natural resources, as well as the urban expansion for housing construction and other infrastructures. The population growth in the region can inevitably leads to climate changes and modifications in the fauna and flora.

The cerebral cortex is divided into two halves called cerebral hemispheres. each cerebral hemisphere has three lobes, the parietal lobe, the frontal lobe, and the occipital lobe.

a. True
b. False

Answers

False there are four lobes

The cerebral hemisphere has four lobes, so the above statement is false.

What is Cerebral cortex?

The Cerebral cortex also known as gray matter which comprises the brain’s outermost layer of nerve cell tissue and has a wrinkled appearance from its many folds and grooves. These folds have many groups called sulci and raised areas are called gyri.

These folds add to the surface area of cerebral cortex which allows large amount of information to be processed by Nerve cells. Cerebral cortex makes about half of the total brain mass. It consists of 6 layers which contains approximately 14 to 16 billion Nerve cells, thickness of about 0. 2 mm to 4 mm.

It is divided into four lobes. They are Frontal, Parietal, Temporal and Occipital which is responsible for processing different types of information.

It consist of nerve cell bodies which include end portion of Nerve cells called dendrites that's why it is also called gray matter. These dendrites receive chemical message from another cell cerebral cortex. It is gray in colour because lack of fatty covering of nerve which is called my myelin.

Thus, the cerebral hemisphere has four lobes, so the above statement is false.

Learn more about Cerebral hemisphere, here:

https://brainly.com/question/13543441

#SPJ12

Question 11
You read a news report about a recent large volcanic eruption. It was reported
that the eruption was highly explosive with viscous lava. What type of volcano was
likely responsible for the eruption?
(Hint: the most explosive, dangerous kind)
A cinder cone

B composite

Cshield

Answers

The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.

What is volcano?

A volcano has been defined as the hill or mountain or it has an opening in a planet or moon's crust from which molten rock, warm gases, and materials erupt. It has a landform where molten rocks erupt through the surface of the planet and volcano moutains open downwards to molten rocks.

According to Geologists there's are four types of volcanoes and these are lava domes, shield volcanoes, composite volcanoes, and cinder cones.

Therefore, The type of volcano was likely responsible for the eruption volcano to its formation would be the composite volcano wherein it usually yields large and violent eruptions.

Learn more about volcano on:

https://brainly.com/question/13428729

#SPJ1

Enzymes_______activation energy and______up chemical reactions.
A. lower, speed
B. speed, lower
C. lower, slow

Answers

Answer:

A: lower, speed

Explanation:

Enzymes definitely speed up chemical reactions because they are proteins that act as biological catalysts. Catalysts speed up reactions without being used up themselves. They are reusable.

Lowering the activation energy makes the reaction faster because less energy is required to do the same task.

B and C do not make sense because speed activation energy doesn't make sense and slow up doesn't make sense either.

watts.
6. Solve a One-Step
Equation A hair dryer is
rated at 1,200 watts. If you
use the dryer for 0.25 hours,
how much electric energy do
you use?

Answers

The electrical energy consumed is 0.3 kWh. Electrical energy is energy related to forces on electrically charged particles and electrically charged particle movement.

What is electrical energy?Electrical energy is the ability of an atom's charged particles to perform an action or move an object. Electrical energy is produced by the movement of electrons from one atom to another. When you plug in a toaster or a cellphone charger into a wall outlet, electrical energy is used to power those devices. Electricity can be either kinetic or potential.Batteries, lightning, and electrical charges moving through a wire plugged into a wall socket to power electrical appliances such as televisions and computers are all examples of electrical energy. It now even powers many of our automobiles. It can be found in the clouds above you during a storm even if you travel to the most remote parts of the planet.

Therefore,

The amount of electrical energy consumed can be calculated as follows:

E = Pt

where;

P is the power (kW)

t is time (h)

E = 1.2 kW x 0.25 h

E = 0.3 kWh

As a result, the total amount of electrical energy consumed is 0.3 kWh.

To learn more about electrical energy, refer to:

https://brainly.com/question/874116

#SPJ13

primates have long growth and development periods because:

Answers

Primates have long growth and development periods because: they have larger brains and higher intelligence as compared to other organisms.

Primates is the order of the class Mammalia. They are different and more advanced from all the other animals. They have more intelligence, five-digit feet and hand, more vision power than smelling power and slower growth. Their life span is also very large.

Brain is the most complex and largest organ of the body. It is the master regulator of all the actions of the body. The brain is divided into left and right hemispheres. There are three sections of the brain: forebrain, midbrain and hindbrain.

To know more about brain, here

brainly.com/question/5361122

#SPJ1

According to the theory of endosymbiosis, a mitochondria or chloroplast may have been a prey species and was engulfed by a cell or it could have been a parasite that entered the cell. WHY do scientists think that the cell did not destroy or remove these structures?

A: because they competed with the cell

B: because the structures benefited the cell​

Answers

Answer:

Because the structures benefited the cell​

Explanation:

Scientists believe that host cells and bacteria formed a mutually beneficial endosymbiotic relationship when the host cells ingested aerobic bacteria and cyanobacteria but did not destroy them.

What’s the correct answer answer asap for brainlist

Answers

Actin and myosin  come in and out of the cell to make it thicker or thinner which changes its length.

The correct option is B.

What is myosin in muscle contraction?

Myosin contracts the myofibrils by sliding along myosin within the sarcomere, a process that demands ATP. Numerous molecules, including as calcium, troponin, and tropomyosin, that control muscle contractions and motor behaviors have also been found by researchers.

What are the uses of myosin?

All hundred billion cells that make up the human body depend on myosins for growth and tissue creation, respiration, reproduction, communication, reshaping, and motion. Furthermore, myosins allow the quick invasion of bacteria, viruses, and parasites into eukaryotes host cells.

To know more about Myosin visit:

https://brainly.com/question/14988876

#SPJ13

The complete question is-

What is involve in a muscle contraction ?

A-The gap junction between the cells pull them close together  which shortens the muscle.

B-Actin and myosin  come in and out of the cell to make it thicker or thinner which changes its length.

C-Myofibrils in the muscle shorten ands lengthen to make the muscle D-contract and extend.

D-The extra nuclei trigger nerve to stiffen  the muscles  and make them shorter.

You work with the Environmental Protection Agency and are attempting todetermine hazard levels for the insurance company. Which of the followingindividuals has the lowest risk of getting cancer?A. Someone taking hormone therapyB. A smokerC. Someone infected with HPVD. Someone getting heart bypass surgery

Answers

The individual with the lowest risk of getting cancer is someone getting a heart bypass surgery. Even though surgeries have riks, cancer is not one of them, and the rest of the conditions (HPV, hormone therapy and smoking) are fact

9. During which phase does the DNA make
a copy of itself?
a. prophase
b. metaphase
c. interphase
d. anaphase

Answers

Answer: A

Explanation:

!!!!

Why isn’t the mitochondria classified as part of the endomenbrame system

Answers

The endomembrane system encompasses the organelles that mediate the importa, export of molecules, that is, the transport of molecules from the environment to the cytoplasm and from the cytoplasm to the environment, respectively. The organelles that participate in such activities are the endoplasmic reticulum, the golgi apparatus, vacuoles and the cell membrane. Mithocondria's main purpose is energy production through oxidation of the carbohydrates/lipids we consume, thus, it is not related to molecule transport, and it can not be part of the endomembrane system.

I’m am unsure of the steps to solve this and what to get for the answer

Answers

Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.

Mutation 1

5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'

Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.

3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'

Same sequence but from 5' - 3':

5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'

Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:

Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys

It should be noted that each chain will give rise to different amino acid sequences.

During what phase of the cell cycle do chromosomes replicate?

Answers

The phase of the cell cycle in which chromosomes replicate is the S phase.

What is Cell cycle?

This is referred to as the series of events that take place in a cell during the process of reproduction an d in this scenario , the parent cells divide which gives rise to two daughter cells. Chromosome on the other hand is a thread like structure which is made up of DNA.

The S phase occurs between G₁ phase and G₂ phase and is an important process in mitosis as the DNA in the nucleus are synthesized and the traits present are usually passed to the offspring.

Read more about Cell division here https://brainly.com/question/796780

#SPJ1

What is the correct term for microbial action that converts inorganic phosphorous back into organic phosphorous?The process ofrefers to the conversion of inorganic phosphorous to organic phosphorous.

Answers

Phosphorous

Phosphorus is very important for life because it makes up important structures in animals, supporting and allowing life.

In the biogeochemical cycle, during the immobilization process, inorganic phosphorus is converted into organic phosphorus and can be absorbed by living cells in the soil.

Therefore, the name of the process that converts inorganic phosphorus into organic phosphorus is immobilization.

what is the process that allows CO2 and glucose to enters the plants cells chloroplast

Answers

Answer: photosynthesis

Explanation:

photosynthesis

Plants use energy from sunlight to turn water and carbon dioxide into an energy-rich sugar called glucose. This process is called photosynthesis, which means “making things with light”. Photosynthesis takes place inside capsules in the leaf cells, called CHLOROPLASTS.

Given: dna codon chart, DNA sequence.DNA sequence given is: 3’ TAC CCC GAT AAA ATA CAT TTA GGA TCG CGA TGG TAT 5’How do you transcribe the DNA sequence into mRNA?And can you underline or highlight on the sequence the codons for Proline and Tyrosineand label which is which? Thanks

Answers

Step 1:

The process of DNA transcription occurs from the 5' to 3' being the DNA sequence in the correct order for transcription as follow:

5' TAT GGT AGC GCT AGG ATT TAC ATA AAA TAG CCC CAT 3'

Step 2:

Resulting in the mRNA:

5' AUA CCA UCG CGA UCC UAA AUG UAU UUU AUC GGG GUA 3'

- Being the nucleotide thymine replaced by uracil in the formation of the RNA strand.

Step 3:

The codons sequence that form proline and tyrosine are:

Proline: CCA;

Tyrosine: UAU.

which statement best describes an example of how climate change leads to decreased biodiversity?
A. Increased rains in dry regions cause more plants to grow,
increasing the ecosystem's resiliency.
B. High temperatures become more common farther from the
equator, leading to increased stability of the ecosystem.
C. Warmer arctic regions allow for increased animal populations,
changing the ecosystem's resiliency.
0
D. Sea levels rise due to increased temperatures, flooding coastal
areas and leading to an unstable ecosystem.

Answers

The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.

What is Ecosystem?

This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.

An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.

Read more about Ecosystem here https://brainly.com/question/842527

#SPJ1

Which action would most likely lead scientists to change or improve an existing scientific theory about evolution?

Answers

Answer: Gathering new evidence using new technologies or procedures most likely will lead scientists to change or improve an existing scientific theory (Option D).

Explanation:

found more than 400 different mutations in the PAH enzyme that are associated with PKU disease. how many alleles can be found in one individual?

Answers

you can only have 2 alleles per gene

When a trait has three or more distinct alleles, we refer to it as having multiple alleles inheritance. The human ABO blood type alleles/trait is an example of a trait with multiple alleles.

Which relationship is an example of predation?

Answers

An example of predation is D) Chickens peck at the ground and eat many types of insects.

Predation is a type of biological interaction in which a predator feeds on its prey. In the above example, chickens are the predators that make insects their prey.

In order for an ecosystem to be healthy, predators are essential. There is more food available for the survival and success of healthy prey species after predators take away vulnerable prey, such as the young, old, sick, injured, or very young. Predators also aid in reducing the size of prey populations, which slows the spread of illness.

What are the types of biological interaction?

Mutualism, commensalism, competition, and predation are the four basic forms of two-way biological interactions between species found in ecological webs (which include herbivory and parasitism).

Therefore, D) Chickens pecking at the ground and eating many types of insects is an example of predation.

To know more about biological interaction, click on https://brainly.com/question/28459604

#SPJ9

What is true about the relationship between cells and the organism they are part of?
Group of answer choices

Cells make up the basic structure of an organism, and they perform basic life functions for the organism.

Cells perform basic life functions for the organism, but they do not make up the basic structure of an organism.

Cells make up the basic structure of an organism, but they do not perform basic life functions for the organism.

Cells do not make up the basic structure of an organism, and they do not perform basic life functions for the organism.

Answers

The true statement regarding the relationship between cells and organism is that cells make up the basic structure of an organism, and they perform basic life functions for the organism (option A).

What is a cell?

A cell is the basic unit of a living organism, consisting of a quantity of protoplasm surrounded by a cell membrane, which is able to synthesize proteins and replicate itself.

A cell is the basic unit of every living organisms meaning that a performs the basic function of living organisms. For example, the photosynthetic ability of a cell is a function of the chloroplast in the cell.

According to the cell theory proposed in the 1890's, which is the scientific theory that all living organisms are made of cells as the smallest functional unit, the cell is the basic functional and structural unit of living things.

Therefore, it can be said that a cell is the basic functional unit of the cell.

Learn more about cell at: https://brainly.com/question/3142913

#SPJ1

A gecko, which has a spinal column and climb walls, can be classified as what type of animal? An ArachnidAn AmphibianAn invertebrateA vertebrate

Answers

Given the characteristics provided: a spinal column and climbing walls; we can classify the gecko as a vertebrate because it has a spinal column (option D).

To make a more specific classification, we would need to know more characteristics of the gecko.

Looking at your data, which color light was needed the most by chlorophyll during photosynthesis? (Hint: which color light was absorbed the most in your experiment?) Question 9 options:redbluegreen

Answers

Chlorophyl absorbs the light at both endpoints of the visual expectrum, which means that ir absorbs the light of the blue and red wavelenghts.

The red wavelength is absorved on a higher rate than the blue wavelength.

Lamin A is a signaling protein embedded in the cell membrane. The locus of the lamin A gene is 1q22. On which human chromosome, arm, and position can the recipe for this protein be found?

Answers

Generally , these proteins are located in the nuclear lamina.

What is Lamin A ?

Instructions for creating a number of slightly different proteins known as lamins are provided by the LMNA gene. Most of the cells in the body make lamin A and lamin C, the two main proteins produced by this gene. These proteins are constructed from a pattern of virtually identical protein building units (amino acids). Lamin A is longer than lamin C due to the minute variation in the sequence.

These proteins are specifically found in the nuclear lamina, a layer of intermediate filaments and other proteins that is connected to the nuclear envelope's inner membrane. The nuclear envelope controls how molecules enter and exit the nucleus.

Learn more about nuclear lamina from given link

https://brainly.com/question/14986847

#SPJ13

Other Questions
which statement best characterizes international market segmentation? multiple choice it makes it easy to compare characteristics across nations. it is easier to conduct than domestic market segmentation. it is a challenging process to complete. it typically does not provide any useful data. it is a relatively inexpensive process. Which equations are true for x = 2 and x = 2? Select two options x2 4 = 0 x2 = 4 3x2 + 12 = 0 4x2 = 16 2(x 2)2 = 0 a survey of 240 households.91 had a dog. 70 had a cat. 31 had a cat and dog. 91 had neither a cat or a dog and did not have a parakeet. 7 had a cat, a dog and a parakeet. how many had a parakeet only? Which feature forms when one plate is forced to bend and dive under the other? 6+|2x-11|=-37Solve for x write a program that determines the number of years it will take a home to double in value given the current value of the home and the predicted appreciation rate. Let S be the universal set, where: S = { 1 , 2 , 3 , ... , 18 , 19 , 20 } Let sets A and B be subsets of S , where: Set A = { 2 , 5 , 9 , 11 , 12 , 14 , 15 , 17 , 18 } Set B = { 4 , 7 , 8 , 9 , 10 , 12 , 15 , 17 , 18 , 19 , 20 } Find the following: LIST the elements in the set ( A B ): ( A B ) = { } Enter the elements as a list, separated by commas. If the result is the empty set, enter DNE LIST the elements in the set ( A B ): ( A B ) = { } Enter the elements as a list, separated by commas. If the result is the empty set, enter DNE Louis and Jenny each wrote an equation to represent the graphed linear function. Louiss answer is y=2x. Jennys answer is y=x+2. Which student is correct? Which of the following would be likely to support completion the Intercolonial Railway? Explain the reasons why each group you select would support it. the United States government a lumber producer in New Brunswick a stove manufacturing factory in Sarnia, CanadaWest a store owner in Vancouver, B.C. a British bank a shareholder in the Grand Trunk Railwa Which of the following are true of early theories of absolutism? Select all that apply.Bossuet argued that there were no legal limitations or constraints placed on the monarch save that he was answerable to God.Hobbes argued that people obeyed the monarch primarily from a place of fear of retribution.Bossuet firmly rejected the principle of divine right monarchy, arguing that the authority of the monarch was predicated on the submission of the people to his or her will.Bodin argued that the monarch should act as a beneficent paternal figure whose primary function was law making.Locke promoted the idea that the monarchs exercised absolute power within the bounds of the social contract, which was divinely ordained and fundamentally unbreakable. who said the british is comming PLSSS HELP IF YOU TURLY KNOW THISS Decide whether each statement is sometimes true, always true, or never true. If the statement is sometimes true give one example of when it is true and an example of when it is not. See Instructions."The linear regression line passes through the average of the x-values and the average of the y-values."Your answer:See Instructions. "A positive correlation coefficient means that the points in the scatterplot are very close together."Your answer:See Instructions."A correlation coefficient close to 1 means that a linear model is most appropriate for the data."Your answer: Why does the author include the section "Famous words have echoed throughout history"?(A)(B)(C)(D)to highlight the problems with the language of the declaration and how they were solvedto illustrate what caused some ideas to be left out of the declaration and their later effectsto compare the reactions of men and women to the language used in the declarationto explain the pros and cons of including ideas about women and slaves in the declaration anumeha mows lawns she charges an initial fee and constant fee for each hour of work when the membrane potential become more positive, changing for example from -70 mv to -50 mv, this is called . question 22 options: hyperpolarization nonpolarization depolarization repolarization g if the mexican nominal exchange rate (foreign currency per peso) does not change, but prices rise faster in mexico than in all other countries, then the mexican real exchange rate a. rises. b. cannot be determined without more information. c. does not change. d. declines. The disappearance of the Mayan civilization from the Yucatan Peninsula in Mexico is a mystery that archacologists have been trying to solve. Scientists have collected data from theformations in caves, sediment, and tree rings. Analysis of the data resulted in the following graphs.Which explanation is supported by the data as to the disappearance of the Mayan people?A.The increase in sulfur in the sediment caused acid rain. Acid rain killed all of the crops. Without an ample source of food, the Mayan population decreased as a result of starvation.B. Pure oxygen is deadly to living organisms. The rise in oxygen levels caused the surrounding organisms to die. This left any surviving Mayan people without a source of food.C.The Mesoamerican peoples of the Postclassic era fought with and defeated the Mayans. The Mayan population was greatly reduced. Any remaining Mayans assimilated with thevictorious peoples.D. A change in the regional climate resulting in a period of drought, as indicated by the increase in oxygen and sulfur in the tested samples, caused the failure of the Mayan civilization. please solve quickly and give solution first then explain if possible do you think the colonists should have been given the right to have a say in government?