Read the excerpt from David Foster Wallace's Infinite Jest
It's clear that this really pretty sincere yellow Dean at left is Admissions. And surely the little awarian figure
right is Athletics, then, because the facial creases of the shaggy middle Dean are now pursed in a kind of
distanced affront, an I'm-eating-something-that-makes-mereally appreciate-the-presence-of-whateverm-
drinking-along-with-it look that spells professionally Academic reservations,
Why does the narrator most likely refer to the deans by their titles rather than their names?
O to distance himself from those present
O to show a personal connection with the group
O to explain his position in relation to the others
O to set a formal tone for the meeting

Answers

Answer 1

Answer:

to distance himself from those present

Explanation:

According to the excerpt from David Foster Wallace's Infinite Jest, the narrator describes the different deans by their titles rather than names. He describes the Dean of Admissions, Athletics and Academics.

The most likely reason the narrator refers to them by their titles rather than names is to distance himself from those present.


Related Questions

Based on this passage, what is the best
characterization of Kahlo?
O She liked to be fashionable.
She was independent.
She often followed others.
She obeyed tradition.

Answers

ccccccccccccccccccccccvccccc

The answer is c! I took the test

Allison is the ______ of my two daughters while Rebecca is ______.
Select one:

a.
more sensitive; sillier

b.
more sensitive; silliest

c.
most sensitive; sillier

d.
most sensitive; silliest

e.
sensitivest; more sillier

Answers

Answer:

The answer is C because if you put it together it makes sence.

Explanation:

Hope this helps

Answer:

C.

Explanation:

If you read the sentence aloud, include each word in the blank spaces.

a: Allison is the more sensitive one of my two daughters, while Rebecca is sillier.

b: Allison is the more sensitive one of my two daughters, while Rebecca is silliest.

c: Allison is the most sensitive one of my two daughters, while Rebecca is sillier

d: Allison is the most sensitive one of my two daughters while Rebecca is silliest.

e: Allison is the sensitivest one of my two daughters while Rebecca is more sillier.

When you take a look at A, it doesn't seem right.

When looking at B, you can see that "Silliest" does not fit in that sentence properly.

When looking at C, you can see that it seems correct, she is the most sensitive of the two, whereas Rebecca is more silly than Allison.

Take a look at d, silliest should be replaced with sillier.

And finally, take a look at e. Sensitivest is not a word, and "more sillier" is very incorrect.

Always remember to analyze these questions like this, and it will help you to succeed!

How does the organizational structure of the passage help develop the main idea? Handwritten cards sent through the mail are the most meaningful way to communicate with someone you care about. First of all, sending a handwritten card takes planning. You have to purchase a card, look up the recipient's address, and find a stamp to mail it. A handwritten card is also a meaningful keepsake because the recipient can display it or keep it in a special place to look at again and again. Finally, the recipient can enjoy a handwritten card without feeling the need to respond immediately. A The chronological structure traces the decline of handwritten​

Answers

Answer:

its c or d

Explanation:

i don't know wich one ill add a coment later ima guess

Describe two scenes where “manipulation” is occurring.
Cukoon’s Nest chapters 1-3

Answers

Answer:

The two scenes where 'manipulation' occurs in the novel 'One Flew Over the Cuckoo's Nest' are:

When Big Nurse gets mad with the aides and quickly brings back her fake posture before the patients.Another manipulation takes place when McMurphy bets with Hardings, the president of patient's council and win against him.

Explanation:

'One Flew Over The Cuckoo's Nest' is a novel written by Ken Kesey. The book is narrated by Chief Bromden.

In Chapter 1-3, the two scenes where 'manipulation' occurs is when Big Nurse gets mad with the ward aides, almost about to burst, but then compose herself before the patients arrive at the spot (Chapter 1). Big Nurse is the antagonist of the novel and the main manipulator. She has manipulated her ward with fear and hatred for one another. She brings control over her wards using these tactics and scheme. But before patients she shows herself as a compose and calm lady. This is one example of manipulation from the novel.

Another 'manipulative' scene occurs when McMurphy bets with Hardings, who is considered to be the president of the patient's council. Hardings is a nerrvous man, which McMurphy knew, he knew that gaining position from Hardings would be easy and thus engage himself in a bet with him, which he easily wins. This incident takes place in chapter 3 of the novel.

Select the correct answer.
What does the body paragraph in an essay contain?
A.the details that support the essays main point
B.the introduction of the essay's topic
C.a restatement c"he essay's topic and main point
Da conclusion for the entire essay

Answers

Answer:

its A

Explanation:

why t f did my answer get deleted its literally A

Answer : A
Explanation : because the body builds up the details to support your thesis

If a celebrity was to come speak at your school, what celebrity would you choose to speak? ​

Answers

Answer:

Steph curry

Explanation:

look at curry man

What is the most convenient way to study?

Answers

Answer:

Secluded area by oneself

Explanation:

Being in a secluded area where no one can bother you is the most convenient way to study for there are no distractions near you.

try to eliminate distractions while studying. this goes for your phone, laptop, gaming consoles, etc. anything that you find yourself gravitating towards while studying should be put across your room or even in a seperate room. i also recomend chill, peaceful music in the background. nothing that gets you hype! just something that can ease your mind. i also recommend breaks! 30 minute breaks help you unwind and release the boredom that comes with studying.

Magic and the brain
Lines 1–9: What words and phrases make the anecdote especially vivid? What effect does word choice have on this opening paragraph?

PLSSSSSSS I WILL MARK BRAINLIEST

Answers

Answer:

The words and phrases make the anecdote especially vivid are explained below in details.

Explanation:

The terms that make the joke definite are adjectives like "flashes", "small", "White" "bright", "red", "redness." The slogans that make the anecdote definite are the descriptive idioms that display what is appearing in the narrative being told, among these slogans we can quote: "The flashlight flashes on the magician's assistant", "The excellent Tonsoni declares he will change her attire from white to red", "The woman is awash in a flood of redness."

If the setting of a story is a deserted soccer field, which character most closely connects with this setting?

Answers

someone who used to play soccer

Identify if the following claim is effective:

Skateboarders and rollerbladers need a public skate park so the mayor should agree to build one there

True

False

Answers

Answer:

True

Explanation:

my dad is a border and he needs to skate in a public skate parke.  

Read this passage from "August Heat" and think about what it tells the reader about the theme of the story:

“I rolled up the sketch, and without quite knowing why, placed it in my pocket. Then with the rare sense of happiness which the knowledge of a good thing well done gives, I left the house.”

What theme do these details about James suggest?

Question 7 options:

People should take good care of their possessions.


Working hard is an important life skill.


Many times we do things that are out of our control.

Answers

Answer:

Based on this i would say working hard is an important life skill however I feel like if I read the whole thing my answer would differ but I'm certain based on this paragraph that it isn't the last option but I haven't read the whole story so I'm not sure I would go with Working hard is a important skill

Is the following sentence a complete sentence or a fragment? Motivational speeches become a popular trend high school
Select one :
A. Motivational speeches have become a popular trend in high school programs
B. Motivational speeches becoming a popular trend in high school programs
C. Motivational speeches, a popular trend in high school programs
D. The sentence is correct

Answers

Answer:

I think it a fragment

B. Motivational speeches becoming a popular trend in high school programs

Explanation:

why does rachel say only it's too late after describing her birthday party

Answers

Answer:

what book is this supposed to be on?

Explanation:

I'm pretty sure i have coronavirus and i dont know what to do

will give brainliest need advice

Answers

Answer:

Well Theres this treatment u can try where u drink like tea and add lemon and stuff like that and ginger and it helps you

Explanation:

you should ask if you can take a test but try to stay from people as much and Always wear a mask even inside your home but get the blue ones they seam safer

DRink alot of water

If you have a medical appointment, notify your healthcare provider ahead of time that you have or may have CO VID-19.

Stay in a specific room and away from other people in your home. If possible, use a separate bathroom. If you must be around others, wear a mask.

You will get through this<3

I need help please !!!!!

Answers

It is A

plz what is your favoirte song by drake

Answer:

c

Explanation:

7.
Question 7
Which best describes the “prudent person” rule?

Answers

The prudent-person rule is a legal principle that is used to restrict the choices of the financial manager of an account to the types of investments that a person seeking reasonable income and preservation of capital might buy for his or her own portfolio.

Identify the colloquial speech.

I’m gonna do it, I just need more time.
a.
gonna
c.
more
b.
just
d.
I’m


Please select the best answer from the choices provided

A
B
C
D

Answers

A. Gonna

Hope it helps

This is about a book, but i couldn't find a reading category so English is the closes.
Anyways the question:
I need some traits of the characters from the book "The Outsiders" NOT the "The Outsider" by Stephen king. If you've read the book please help if you haven't, move on.

Answers

Answer:

soda pops like a mom hes caring

ponyboy is wimpy in a way

darry he is like a boss

twobit is scary like manly

Explanation:

Read this excerpt from "Eavesdropping" by Eudora Welty and answer the question.

What they talked about, I have no idea … . It was no doubt whatever a young married couple spending their first time privately in each other’s company in the long, probably harried day would talk about. It was the murmur of their voices, the back-and-forth, the unnoticed stretching away of time between my bedtime and theirs, that made me bask there at my distance. What I felt was not that I was excluded from them but that I was included, in – and because of – what I could hear in their voices and what I could see of their faces in the cone of yellow light under the brown-scorched shade.

In this excerpt, Welty’s diction best suggests she is writing to what possible audience?

young married couples who want to improve their relationship
young people who read
thoughtful readers interested in writing and literature
students in college

Answers

Answer:

thoughtful readers interested in  writing and literature

Explanation:

i believe it is this answer. it is not the first one because it has no marriage advice. it is not the second since it is too general. it is not the final answer since it is a book for all ages. it is the 3rd answer because it is a literature book. this is why the answer is #3.

1. How did Jeannette catch on fire in the beginning of the novel? *
1 point
a. She was making herself pasta while Rose Mary watched and painted.
b. She was testing chemical reactions with toxic chemicals in a shed near her house.
c. She was throwing toilet paper that was on fire down the toilet.
d. She was cooking hot dogs by herself.

Answers

Answer:

D. She was cooking hot dogs by herself.

Explanation:

Jeannette is 3 years old in the novel, and more often then she should've, cooked herself hot dogs on the stove by herself. The gas flame from the stove catches her dress on fire when she got too close.

imagery in God see the truth but waits
Show me 7 or 8 imagery answers and get LOTS OF POINTS CROWN AND BRAINLYIEST ​

Answers

Answer: telletubbies!! dekndcwdmmwmdkwmkcec

Explanation: yes

Identify the error in the sentence.

I'm so incredibly tired; because I didn't sleep well last night.
a.
I'm
c.
;
b.
incredibly
d.
didn't


Please select the best answer from the choices provided

Answers

Answer:

c.   ;

Explanation:

Remove the semi-colon; no punctuation is needed there.

Answer:

the answer would be c ; bc you dont need them there

What is the one thing that you think sets you apart from other candidates applying to the University of California?

Answers

Answer:

Anything it could be grades or even the life skills you use. Also the way you put yourself out there.

Explanation:

hope this help i wasn't really sure.

where are you most likley to conduct most of your research

Answers

Depends on what kind of research your trying to do but I would say the internet 100%

Which statement reveals Kamkwamba's ability to overcome obstacles?
He didn't care about getting an education and chose to leave school.

He felt bad for himself and gave up on learning after dropping out.

He found a way to keep learning after he was forced to drop out.​

Answers

Answer:

the last one

Explanation:

i got it right

Answer:

C

Explanation:

Select TWO connotations of the words gives :

Remind, nag.

A. Remind has a positive connotation.
B. Remind has a negative connotation.
C. Nah has a positive connotation.
D. Remind has a neutral connotation.
E. Nag has a neutral connotation.
F. Nag has a negative connotation.

Answers

Answer:

b e

Explanation: ik

Read the following passage: The basketball team should find a new coach. Sure, the old coach has won two titles in the past three years, but he's hard to be around, and his fashion sense is terrible.

Which statement best evaluates the use of a claim and reasoning?

A. The passage does not have a claim and does not contain any sound reasoning

B. The passage does not have a claim but does contain sound reasoning

C. The passage has a strong claim backed up by sound reasoning.

D. The passage has a strong claim that is not backed up by sound reasoning.​

Answers

Answer:

I actually don't know possibly c

Answer: it’s d

Explanation:

I NEED HELP ASAP!!!!!!! MARKING BRAINLIEST TO THE FIRST PERSON TO ANSWER!!
In what part of a paragraph will a reader find the main idea?

A.in the body paragraphs
B.in the conclusion
C.in the topic sentence
D.in the supporting details

Answers

Answer:

C. In the topic Sentence

Explanation:

Answer:

Topic sentence

Explanation:

Its the best anwser

3
SS13
Crutch Words, Informal Speech
A speaker says:
You know, I'm afraid you're just too loud. Like, seriously, you need to
calm down.
Which of the following is the correct way to transcribe this according to
our Clean Verbatim Style Guide?
A) I am afraid you are just too loud. You need to calm down.
B) I'm afraid you're just too loud. Seriously, you need to calm down.
C) You know, I'm afraid you're just too loud. Like, seriously, you need to
calm down.

Answers

Answer:

A) I am afraid you are just too loud. You need to calm down.

Explanation:

Clean Verbatim is the method of transcribing in which the transcription is clarified for the easy reading and understanding. The clear meaning is derived from the speech by removing the crutch words and fillers. The informal words are excluded from the speech.

From the given speech, crutch words and fillers alike 'you know', 'like' and 'seriously' has been removed.

Becoming a Dragon Champion (excerpt) Lotta Carl “I’ll never get Remus ready for the competition at this rate!” Jada said. Jada stood up and wiped the dust off her cloak. She had fallen onto the ground after Remus, her pet dragon, had accidentally knocked her over with his tail. Remus was still a young dragon and had not yet mastered taking off, landing, or other important dragon skills. Remus walked over to Jada and put his head down. “It’s okay, buddy,” she said. “Miguel, can you help me put Remus back into the barn? I don’t want to be late for the first-day banquette.” “Come on, Remus,” said Miguel. “Follow Igor back to the barn.” Remus obeyed Miguel’s command and followed Igor, whose dragon skills were a little more developed, back to the barn. “Don’t be discouraged, Jada,” said Miguel. It takes a long time for these dragons to learn to fly properly. Igor is a little more advanced because he is a few months older than Remus.” “I know. But the Dragon Championship is only a month away, and I’ve already seen some dragons soaring over the school and even breathing fire!” she said. “Well, we had better go in and join the banquet. Everyone will be wondering where we are.” By the time the friends walked into the hall, most of the students had already started eating. Jada and Miguel walked through the line, filled their plates with food, and took a seat at one of the long tables. Jada and Miguel were second-year students at the Greenhaven Academy. Jada was one of only thirty students accepted to the school last year.

Which is the best description of the relationship established between Jada and Miguel? A) Jada is jealous of Miguel. B) Miguel is jealous of Jada. C) Jada is supportive of Miguel. DE) Miguel is supportive of Jada.

Answers

Answer:

D) Miguel is supportive of Jada

Explanation:

It says "Don't be discouraged Jada," said Miguel.

Other Questions
GUse the graph to answer the question.y6R543-21O3What are the coordinates of point R on the graph? Choose numbers to move to the lines to answer the question,56012 I need answer as quick 0.45 g of hydrated sodium carbonate crystals were heated until 3.87 of anhydrous power remained.How many moles of water are there in one mole of hydrated salt? Will mark as brainliest!!!!!!!!!! X3.1.PS-7QuestionA local little league has a total of 60 players, of whom 40% are right-handed. How manyright-handed players are there? what do you divide (-2/3) with to get 3/10 AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 plz help i need help im failing Simplify as far as possible.182 I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Who are the most aggressive of the types we looked at? what's the pagathorium theorem A power pole 10 m tall casts a shadow 8 meters long, at the same time that a building nearby casts a shadow 14 m long. How tall is the building? The movement of water in or out of the cell membrane without the use of ATP.Diffusion Facilitated diffusion OsmosisExcoytosis Escoger Circle the item that does not belong.1.c. la papelera Ca. la tizab. la pluma2.a. la geografac. la economab. el libroB3.a. la mochilab. la puertac. la ventana4.a. la residencia estudiantilb. la casac. la tarea5.a. la pizarrab. el trimestrec. el mapa6.a. el inglsb. el espaolc. el arte A cube with a volume of 75 cm is dilated bya factor of 5.What is the volume of the dilated cube?Enter yOur answer in the boxcm