QUICK PLS

Body cells have
____ the number of chromosomes as sex cells.


a: 4times
b: one half
c: one fourth
d: twice

Answers

Answer 1

Answer:

Body cells have twice the number


Related Questions

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died

Answers

Answer:

There are 1600 atoms when organism just died.

Explanation:

The statement is incorrect. The correct statement is:

If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?

The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:

[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)

Where:

[tex]n_{o}[/tex] - Initial amount of atoms.

[tex]n(t)[/tex] - Current amount of atoms.

[tex]t[/tex] - Time, measured in years.

[tex]\tau[/tex] - Time constant, measured in years.

In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:

[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)

If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:

[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]

[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]

[tex]\tau \approx 8,266.643\,yr[/tex]

[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]

[tex]n_{o} \approx 1600[/tex]

There are 1600 atoms when organism just died.

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

Wyatt has heart problems

Answers

???? what is you talking about

Answer:

If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement

Answers

Answer:

paper bags jute bags , cotton bags might be used for the environment

People in the Middle Ages were beginning to question:

Drama
Authority
Scientists

Answers

I think it is Authority hope this helps

How does biology affect behavior?

Answers

Answer:

some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.

Explanation:

There you go

Biology is a normal thing it diesnt really effect us

Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?

Answers

Answer:

Abnormally high temperature

Explanation:

Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.

When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.

1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone​

Answers

Answer:

1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes

Explanation:

The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

structures in the cell

Answers

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass

Answers

Answer:

D. The glass.

Explanation:

Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.

Hope this helps :D

The correct answer is D. The Glass Explanation: since the atoms in solids are closer together they would transfer sound the best, because sound travels best through solids

What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT

Answers

Answer: A U G U G G A A C C G C U G C U G A

Explanation:

Answer:

AUGUGGAACCGCUGCUGA

Explanation:

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

MULTIPLE CHOICE QUESTION
Why do scientists think that cuttlefish
have the biggest brain to body ratio of all
invertebrates (animals without a spine)?

Answers

Answer:

Due to its high intelligence.

Explanation:

Scientists think that cuttlefish  have the biggest brain to body ratio of all  invertebrates that allows it to sense sight, smell, and sound that comes to it in the form of pressure waves. Due to this big brain, cuttlefish are very intelligent so due to its intelligence the scientists thinks that cuttlefish has the biggest brain as compared to other big vertebrates such as octopus.

PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS

Answers

Answer:The answer is the person and the tennis ball :)

Explanation:

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

I WILL GIVE BRAINLIEST
Use the image to answer the question.

The image shows a food chain. An arrow points from grass to a grasshopper. An arrow points from the grasshopper to a lizard. An arrow points from the lizard to a hawk. An arrow points from the hawk to a fox.

What would happen if the number of grasshoppers in this food chain decreased?

A.
The amount of grass would increase.

B.
The number of lizards would increase.

C.
The amount of grass would decrease.

D.
The number of hawks would increase.

Answers

Answer:

a, the amount of grass would increase

Explanation:

if the grasshopper is the one in this diagram eating the grass, and suddenly there were fewer grasshoppers to do that, the grass would increase because more of it can grow without being eaten

Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​

Answers

Answer:

40kg

Explanation:

F=M*A

M=F\A

M=400\10

M=40kg

The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2​ is 40 kg.

What is acceleration due to gravity?

The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.

It is a vector quantity whose direction, strength, or magnitude match a plumb bob.

According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.

We know that,

F = m x g

m = f/g

Where,

F = force

m = mass

g = acceleration due to gravity

Given that,

F = 400N.

g = [tex]10m/s^2[/tex]

So,

m = 400/10

m = 40 kg.

Thus, the mass is 40 kg.

For more details regarding acceleration due to gravity, visit:

https://brainly.com/question/13860566

#SPJ6

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

What determines which bases will be brought to the DNA strand during DNA replication?

Answers

Answer:
Replication relies on complementary base pairing, that is the principle explained by Chargaff's rules: adenine (A) always bonds with thymine (T) and cytosine (C) always bonds with guanine (G).

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

Other Questions
Plant and animal cells both have cell membranes and nuclear membranes. However, plant cells have a structure that animal cells do not, known as a: ____ Select the correct answer from each drop-down menu.Researchers stationed at different areas on a mountain and in a tunnel midway through the mountain boiled water at the same time. Even though the water at every station was at the same temperature, the pot at the top of the mountain started boiling before the others. Why?Water boils when the vapor pressure is the atmospheric pressure. The atmospheric pressure at the top of the mountain. someone please help me, Ive done this like 10 times. What are the values of x and y, based on the figure on the right? How is the president also referred to? Please help- I will try and give a lot of points How much percent did the boil weevil destroy please help im not that good during this online Multiply 2x(x^2-x+3) In the diagram below, what is the approximate length of the minor arc ?XO A. 5.7 cm40"9 cmO B. 7.1 cmNO C. 6.3 cmD. 3.1 cm PLZ HELP!!! What is the purpose of most of the Ulster Scots music? 2x+3x+1=21Solve and show work Why is it said that an alarm clock is going off when really it's coming on? What is the value of Angle 'a'?a47 Wesley wants to have at least $50 to spend each day of his 7-day vacation. He plans to save $30 each month for 12 months. Which of the following shows that Wesley will save enough money for his vacation? Choose all that apply. Factor this polynomial.-3x^2-16x- 5 Explain how autotrophs need both cellular respiration and photosynthesis A soap factory randomly inspects 100 bars of soap to better identify problems that occur during the manufacturing process. The table below displays the possible problems and frequency for each.Soap ProblemsFrequencyUnderweight4Impurities2Broken bar3None91Total100If the soap factory makes 5,000 bars of soap per day, how many of those bars would they expect to be broken?They would expect 100 bars to be broken.They would expect 150 bars to be broken.They would expect 300 bars to be broken.They would expect 450 bars to be broken. Kate saved each week for 5 weeks and then spent $25. How much was she saving each week if she had $100 left at the end of 5 weeks and after spending $25? /3 What conversion factorsdetermine the number ofmolecules from the mass of acompound?