PLSSS HELP! Geologists use rock samples and_________evidence to prove what Earth's ______
is like.

Answers

Answer 1

Answer:

geologists use rock samples and direct evidence to prove what earth's structure is like.

Explanation:


Related Questions

Help. It is due today

Answers

Answer: B

Explanation:  tadpoles lack limbs and possess longtails, adult frogs on the other hand have two hind limbs and two fore limbs

which of the following are part of the central nervous system?​

Answers

Answer:

The central nervous system is made up of the brain and spinal cord

Explanation:

ion if that's the answer you were looking for but here go.

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

explain how water properties help get water from the roots of plants to leaves

Answers

Answer:

In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.

Explanation:

An idea in science is supported or rejected after several

Question 23 options:

publications

experiments

alterations

meetings

Answers

Answer:

experiments

Explanation:

Answer:

experiments

Explanation:

I took the test

And, what else it literally says CHECK ALL THAT APPLY like....

Answers

Answer:

i dont understand??????

Explanation:

Answer:

What??

Explanation:

This makes no sense to me...

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?​

Answers

Answer:

Add magnet to the bowl, cover the bowl, and shake well

Explanation:

Anything with MAGNET

MARKING PEOPLE AS BRAINLIDT IF CORRCET

True or False: Bone cells contain different DNA than blood cells.

Answers

Answer:

True the bone cells do have different DNA than blood

Explanation:

True.
bone cells and blood cells do different things, hence the different DNA

An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as

Answers

Answer:

This organism is best classified as an autotroph.

Explanation:

Autotrophs can make their own food.

Skim the headings and bold words in this section. Write four steps scientists might take to solve a problem.

Answers

Answer:

1) Create a hypothisis 2) Create experiment 3) collect data 4) write conclusion

The four steps that a scientist uses to solve a problem are creating hypothesis, experiment, data sorting and writing conclusion.

What are hypothesis?

A hypothesis is an elaboration posited for a characteristic. The scientific technique requires that a hypothesis be testable in order for it to be considered a scientific hypothesis.

Scientists typically base scientific hypotheses on previous findings that cannot be adequately explained by existing scientific theories.

Any process that co-ordinate system data into some defined order to make it simpler to understand, analyze, or visualize is referred to as data sorting.

The conclusion is the final section of an academic essay. The conclusion should restate your response to the question and briefly summarize key points. It does not contain any new points or information.

A scientist solves a problem by developing a hypothesis, conducting an experiment, sorting data, and writing a conclusion.

Thus, by using these steps, scientist can come to an end for the problem.

For more details regarding hypothesis, visit:

https://brainly.com/question/17173491

#SPJ2

Which statement best
summarizes agricultural technology
over time?
A. Agricultural technology has
continually advanced over time, with
significant leaps forward during the
Agricultural Revolution and the Green
Revolution.
B. Agricultural technology
advanced quickly during the
Agricultural Revolution and the Green
Revolution but hasn't advanced since.
C. Agricultural technology didn't
advance before the Green Revolution.
D. Agricultural technology didn't
advance before the Agricultural
Revolution.

Answers

I believe the answer is A!!!!!

Agricultural technology has evolved over time, with significant leaps during the agricultural and green revolutions.

Agricultural revolution

Agriculture has been one of the sustainers (along with hunting) of early men and as such, has seen gradual development with time. Man has always been looking for better ways to do things in order to achieve outcomes.

With the era of the agricultural revolution, there was a huge transition of humans from the primitive lifestyle of hunting and fruit gatherings to that of agricultural settlements. Better ways to carry out crop production started receiving huge attention. from there, hand-made agricultural equipment started surfacing.

The green revolution has agriculture receiving utmost attention in terms of technological innovations. Farm machinery, agrochemicals, etc, started coming up with the result being a massive increase in crop production and general outputs.

More on agricultural revolutions can be found here: https://brainly.com/question/14121608

#SPJ2

what tissue breaks down food for energy

Answers

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

I need help. Due today.

Answers

Answer:

D) common ancestry among vertebrate species

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

Is a seed a living organism

Answers

Answer:

Yes they are living organisms

Desert plants and animals are adapted to the lack of what and high

Answers

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible

Answer:

lack of water and high concentration of heat and dryness

Explanation:

Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.

hope this helped:)

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA

Answers

Answer: Complementary base- pairing creates a very stable structure

Explanation:

The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.

A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.

In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).

Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.

Read more: https://brainly.com/question/19755749

The most common presenting sign/symptom with rheumatic fever is a. rash. b. painless nodules. c. polyarthritis. d. cardiac murmur.

Answers

Answer:

c. polyarthritis.

Explanation:

Rheumatic fever is an inflammatory disease that may affect different parts of the body including joints, heart, brain, and skin. It is a rare disease observed after a bacterial throat infection caused by Streptococcus (group A). The most common signs of this disease include swollen and/or tender joints (i.e., polyarthritis), especially in wrists, knees, elbows or ankles, fever, fatigue, pain in the chest, breathlessness, palpitations, etc. Rheumatic fever needs to be treated by antibiotics to eliminate group A Streptococcus infections.

Which relationship is an example of commensalim?

Answers

One of the most poplar examples of commensalism is the relationship between cattle egrets and livestock. The cattle egret is a common species of heron that is found in most regions of the world, and is mostly seen moving along with herds of cattle. This bird moves about in pastures, and follows livestock such as cattle and horses.

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

Other Questions
15 * 15 is?YYYYYYYYYYYYYYYYYYYYYYY Explain factors taken into consideration to determine the similarity of a name for it to be called undesirable under section 24 of the Companies Act (Chapter 24:03 CAN ANYBODY GOOD WITH MATH HELP ME OUT PLEASE. I beg you this anaerw man i beg uuiu i dont kno the answer help Juan deposits $1,500 into a savings account that pays 4.5% interest compounded annually. If Juan makes no deposits or withdrawals, how much money will be in his savings account after 3 years? how are Ionic and Covalent Bonds are formed with examples ? what are key words in this? What is a thunderstorm? A thunderstorm is a storm that includes lightning and thunder. Some features of thunderstorms are that they produce strong winds, heavy rain and sometimes hail. Thunderstorms are created when moisture collects to form clouds and rain. Unstable air that is warm and can rise rapidly further aids the process. Finally, lift can form from fronts, sea breezes or mountains to make the perfect environment for a thunderstorm. Thomas ram from the start line to go post and back the distance from the start line to the goalpost is 46 meters how far did Thomas run The sum of two numbers is 55. One number is 4 times as large as the other. What are the numbers?Larger number:Smaller number: When wax is heated, it turns into a liquid. How are the wax molecules affected by this change of state?The molecules gain energy The molecules lose energy The molecules move closer to one anotherThe space between the molecules increaseThe space between the molecules decrease Staffing parades, distributing disaster supply lists, and home safety checks are examples of CERT volunteers performing: A. Community Service B. Required services hours for CERT certification C. Mitigation activities D. Emergency management How many moles are 5.55 x 104 atoms of Mg? PLS HELP ME it's due today and I suck at math!!! I'll make Brainliest (also I know it's a bit hard to see) Is 15625/1000000 between -1 and 0?? Help! Show work! Triangle PQR Triangle XYZPQ = 3a + 4 and XY = 5a 12. Find a and PQ. Using the information given, find the number of Electrons of the unknown element: 6 PROTONS, 6 NEUTRONS, 12 ATOMIC MASS If x = -1, then which of the following inequalities makes a true statement? A. -4x + 9 > 20 B. -4x 5 < -15 C. -3x + 15 18 D. -5x 15 -22 Washington wanted to retired after his first term?(true or false) * i really need help so pls hurry