Patients wear protective gear when being X-rayed. What substance is being protected directly from mutation?

Answers

Answer 1

Answer:

Radiation has a potential of causing germ cell mutations that may be passed on to future generations.

Explanation:

i think so, hopefully this helps;(

Answer 2

Ionizing radiation damage cells and cause double-strand breaks that let more DNA in. These additional fragments of DNA find their way to the nucleus and cause cellular mutations. Protective gears are worn to prevent this.

What are X-rays ?

X-rays are a form of electromagnetic wave radiation. Using X-ray imaging, your body's interior can be visualized. The photos depict the various bodily parts in various shades of black and white. This is due to the fact that various tissues absorb radiation in different ways.

Ionizing radiation, a type of radiation that x-rays create, has the ability to destroy living tissue. This is a risk that gets worse the more exposures someone has over the course of their lifetime. However, exposure to radiation normally carries a low risk of acquiring cancer.

Therefore, protective gears are worn during x-rays to avoid mutations.

Learn more about X-rays, here:

https://brainly.com/question/2833441

#SPJ2


Related Questions

HELP ME PLSSS someone

Answers

Answer: B

Explanation: The amount of salt in the inner circle is equal to the amount of salt in the outer circle.

PLEASE HELP ME!!!


3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.

4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.

Answers

3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)

4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.

According to Chargaff's rule of base pairing, which of the following is true about DNA?
O A=G and C=T
O A=T and C=G
O A=T=G=C
O A=C and G=T

Answers

Answer:

a = t and c = g

Explanation:

just took the test, hope this helps <3

brainliest pls? :)

The Char gaff rule is all about the number of adenine is equal to the number of thymine and with that the number of cytosine is equal to the number of guanine. The correct answer is option B.

What are the types of bonds that are present in between these nitrogenous bases ?

The kind of bonds that are present in these  nitrogenous bases are hydrogen bonds. A binds with T with two hydrogen bonds and C binds with G through 3 hydrogen bonds.

It is all about that the number of purines is equal to the number of pyrimidines. The number of adenine molecule are present totally in equivalence to the number of thymine molecules.

The number of guanine molecules are present in the molecule of DNA are totally in numbers to the cytosine. In place of thymine uracil is present which is present in RNA.

Learn more about DNA at :

https://brainly.com/question/14315652

#SPJ2

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

20 points and brainliest!
More and more often, farmers and food manufacturers are genetically modifying crops to improve flavor, reduce disease, and lower costs. Do you think genetically modifying food is a good idea? Use specific examples and reasons to support your opinion.

Answers

Explanation:

it is a good idea as it increase the life of certain food, also keeps bacteria away

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

What is a likely reason for the change from mitosis to meiosis during reproduction under these conditions?

Answers

it’s b, meiosis is mixing both parent cells genetic information therefore their offspring have a better chance at sieving

Mitosis and meiosis are the two types of cell division, which result in the generation of daughter cells. Yeasts are capable of undergoing meiotic and mitotic division under favorable conditions.

The correct answer is:

Option B: Crossing over genes during meiosis increases diversity and the chance of survival of the next generation.

The significance of meiosis can be explained as:

Meiosis is a reduction division, in which the diploid parent cell gives rise to haploid daughter cells.

The crossing over of the genetic material of the haploid cells leads to genetic diversity and a higher rate of survival.

Meiosis leads to genetic diversity as the data in the parent cells are fused and recombined to give rise to new offspring.

Thus, meiosis is an important step in the genetic variation and survival of the organism.

Therefore, option B is correct.

To know more about meiosis, refer to the following link:

https://brainly.com/question/11622266

What number go in each circle ?
What number go in both circle?

Answers

Answer:

1 goes in the middle of all of the circles. 2 goes in animal cell. 3 goes in plant cell. 4 goes in between animal and plant cell. 5 goes in The middle of all of the circles. 6 goes in the middle of all of the circles. 7 goes in the bacteria circle. 8 goes in bacteria. 9 goes in bacteria.

Also:

8 and 9 I'm not completely sure of. Let me know if I'm wrong. Good Luck! :D

Can you give me a slogan for using compost at home

Answers

Answer:

Mark my answer the brainliest if this helps,

A Partner with the Environment.

Because What You’ve Got is Not Waste.

Clean Up Your Act. Compost.

Compost On Your Mind?

Don’t Burn Our Future.

Eat Smart

Enriching the Soil Naturally.

Feed the Soil.

Fit Energy Saving Light Bulbs

Give Green a Chance

Greening the Hill.

It’s Easy to Do.

Lets Talk Dirty.

Local Composting Made Easy.

Making a Clean Scene.

Making a Compost Pile

Mother Nature Recycles.

Nature’s Way to Grow.

Plant a Garden

Plant Trees

Raking Leaves

Recycle All Recyclable Items

Recycle Your Grey Water

Reduce The Use of Energy

Replenish the Earth for Generations.

Reuse Stuff

Reuse Whatever You Can

Reuse, Reduce and Recycle

Save Water To Save Money

Shoveling The Driveway

Smells Like Green Spirit

So Hot Right Now.

Sustainability Stools.

The Compost People.

The Solution to Sustainable Soil and Water.

Think Before You Buy

Too Good to Waste.

Turn It Off When Not In Use

Use Less Electricity

Walk To Work or Take The Bus

Waste Wise.

We Speak Organic.

We’re Growing.

Zero Waste.

Answer:

mark ssydnie the brainliest

Explanation:

5 tips to improve your critical thinking - Samantha Agoos

Watch the Video and make a summary

Ps: They don't let me paste the link lookup what it says above

Answers

Answer:

that one is hard because we did not see the vidoe

Explanation:

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system​

Answers

Answer:

a. Capillary action of liquid in plant stems

C. Movement of ions to maintain homeostasis

d. Pumping of blood through the circulatory system​

Explanation:

Hope this helped!

In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.

What is Adhesion?

Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.

In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.

Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.

Learn more about adhesion on:

https://brainly.com/question/14457491

#SPJ2

When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?

A. “action” and “reaction”


B. “mass” and “inertia”


C. “inertia” and “force”


D. “force” and “acceleration”

Answers

Answer:

A. action and reaction

Explanation:

the third law is:-

Every Action has it's opposite and equal Reaction

Answer:

The correct answer is "action" and "reaction".

Explanation:

Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

someone pleaseee help me with this !!

Answers

lizards and snakes!

Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?

Answers

Answer:

B and C

Explanation:

I just took the test and it was right

This stuff annoying!!!!!!!!!!!!!!!!!!!!

Answers

wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink  wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink

"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?

Answers

Answer:

by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species

Explanation:

The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.

Answers

Answer: possibly A

Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

in which direction do particles in a solution move during passive transport

Answers

During the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending. The passive transport is seen in the cell too.

What is the importance of the different types of transportation?

In the cell, different types of transport are seen, such as active transport and passive transport; in active transport, energy is used, while energy is not used in passive transport. The movement of molecules across the cell plasma membrane is important because it allows cells to get rid of unwanted molecules. Passive transport does not require energy, and many nonpolar small molecules and gases can cross the lipid plasma membrane barrier and go into and out of the cell while, in this passive transport process, they save the cell's energy.

Hence, during the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending.

Learn more about the different types of transportation here.

https://brainly.com/question/29764225

#SPJ6

can u answer that question

Answers

Answer:

The synthesis of new proteins

Other Questions
List the following in order from least (top) to greatest (bottom).6, 25, 27, V64, 764 HELP please again ;-; I have no clue how to answer this? An artist who uses wet on wet or graded/gradient washes is working in Identifying When to Get HelpPetes parents are out of town, and he decides to throw a party. One of his friends brings alcohol without permission. Pete does not notice how much his friend drinks, but as the evening progresses, Pete finds his friend asleep on the couch. When would Pete need to call 911? Check all that apply.if his friend snores loudlyif his friend has slow or irregular breathingif his friend is unable to wake upif his friend is talking in his sleepif his friend starts vomiting while unconscious can someone please solve this!! translate this sentence to an equation 38 is the product of Malik's score and 2. Use the variable m to represent Malik's score. In less than 7 sentences, how would you describe Earth's magnetic field? What is the answer to 8.7x570.8 Two liabraries donated to a local school. One library donated 786 books and the other library donated 1245 books. The school divided the books evenly among 11 classrooms. Estimate the number of books each classroom received. Check if the answer is reasonable. Which answer best shows an effect of British soldiers firing upon colonists in Boston, killing five of them? The first shots of the American Revolution are fired, which officially starts a war between the colonies and Britain. The Sons of Liberty protest by dumping tea into Boston Harbor, which becomes known as the Boston Tea Party. Samuel Adams uses propaganda about the event to gain colonial support for the Patriots in their fight against the British. Delegates meet at the First Continental Congress to demand that Britain repeal the Coercive (Intolerable) Acts. Which of the traits below are completely influenced by the expression of genes? (Choose all that apply)Group of answer choicesweighthair textureattached or unattached earlobeseye color 20 POINTS!!Kinetic and Potential Energy Which of the following does not contribute to erosion?O LavaOlceO WindO Water What is the bill of rights? EDIT: The answer is A, since none of yall answered soon enough smhA. Amendments that protect individual rightsB. Rights that were opposed by the enlightenmentC. Laws that came from the articles of confederationD. Rights that were approved by the presidentPLEASE HELP!! PLEASE ASAP!!!There are significant differences between critical care provided infants and children and that provided adut patients.True or false The great schism is known for being a split between what two churches A. The Catholics and the ShiaB.the Muslims and the Christians C. The orthodox and the CatholicsD. The Sunnis and the Shia A rectangular cardboard has dimensions as shown. The length of the cardboard can be found by dividing its area by its width. What is the length of the cardboard in inches?Rectangle with width labeled on the right, width equals 4 and 1 over 2 inches. Below the rectangle, it says, length equals question mark. Inside the rectangle, it says area equals 36 and 3 over 4 square inches. 8 and 1 over 6 9 and 3 over 4 32 and 11 over 20 154 and 7 over 20 simplify: 2/3m + m - 1 2/3m I Just got braces any tips?