I’m am unsure of the steps to solve this and what to get for the answer

Im Am Unsure Of The Steps To Solve This And What To Get For The Answer

Answers

Answer 1

Protein synthesis is the process by which information is taken from DNA, passed to RNA by a process called transcription and finally to protein by another process called translation.

Mutation 1

5' AGTTTGCACTTGTAGAGGATGAAGCCGCACGTACATCA 3'

Mutation 1 (transcription): With RNA we use uracil instead of thyimine. We also use the reverse complementary sequence. Since transcription occurs from 3' to 5'.

3' UCAAACGUGAACAUCUCCUACUUCGGCGUGCAUGUAGU 5'

Same sequence but from 5' - 3':

5' UGA-UGU-ACG-UGC-GGC-UUC-AUC-CUC-UAC-AAG-UGC-AAA-CU 3'

Mutation 1 (translation) Finally, the translation occurs from 5' to 3' and we can known the protein sequence using the next table:

Stop-Cys-Thr-Cys-Gly-Phe-Ile-Leu-Tyr-Lys-CysLys

It should be noted that each chain will give rise to different amino acid sequences.

Im Am Unsure Of The Steps To Solve This And What To Get For The Answer

Related Questions

What happens to oil when it enters the water? Explain how this property of oil contributes to the effects of oil spills in ocean ecosystems.

Answers

Oil is insoluble in water. When oil spills in the ocean it creates great "oil islands". These islands are devoid of nutrientes, oxygen or any compound normally found in water. So they represent a massive perturbation to marine biota. Beside this oil disrupts, and frequently kills, marine fauna, such as water birds, and cetaceans.

In a group of teocards, some individuals have a spotted coat and others have a black coat. Inthis group, the gene for the coat pattern trait has two alleles. The allele A is for a spottedcost, and the allele a is for a black coat.Farah is a leopard from this group. Farah's phenotype for the coat pattern trait is a spottedcat. Fera's genotype for the coat pattern gene is AA.Based on this information, complete the following statementfor the coat patter gene,homozygousheterozygous

Answers

The trait of interest is "coat pattern"

There are two observable phenotypes for this trait:

- Spotted coat

-Black coat

This trait is coded by two alleles:

A → code for a spotted coat

a → code for a black coat

Farah is a leopard with the phenotype "spotted coat" and its genotype is AA.

The genotype of this individual has two identical alleles. Genotypes with two identical alleles are called homozygous.

Which of the following has the highest average salinity?
w. Mediterranean Sea
x. Atlantic Ocean
y. Arctic Ocean
Z. Gulf of Mexico

Answers

Salinity is the measure of how much salt has been dissolved in a body of water. It significantly affects conductivity and has an impact on a variety of chemical properties of natural waters, as well as the biological processes that occur there.

Explain about the salinity?

Lake describes the Dead Sea. The Salt Sea is another name for it. With a salinity of 33.7%, the Dead Sea is the saltiest body of water on earth.

Either grams of salt per kilogram of water or parts per thousand are used to express salinity. For instance, your salinity is 1g/kg, or 1 ppt (ppt, or ), if you have 1 gram of salt and 1,000 grams of water. Salt content in freshwater is typically less than 0.5 ppt.

The Atlantic Ocean is the saltiest of the five ocean basins. Near the equator and at both poles, salinity generally decreases noticeably, though for various reasons. The tropics, which are close to the equator, consistently get the most rain.

The answer is Atlantic ocean

To learn more about salinity refer to:

https://brainly.com/question/20283396

#SPJ13

6. Cilia and flagella are used to move substances along the surface of the cell instationary cells. Which of the following is another function of cilia and flagella?A. They hold neighboring cells in a fixed position.B. They move cells through watery environments.C. They transmit waste materials away from the cell.

Answers

Cilia and flagella are structures present in the cells that can be used for movement in aqueous media, such as in the case of spermatozoa (flagellum) and Paramecium (cilia).

This means B, they move cells through watery environments, is the right answer.

Finish the DNA strand using
complementary base pairing rules.
A-G-T-C-T-G-C

Answers

Answer:

T-C-A-G-A-C-G

Explanation:

What are three types of freshwater wetlands?

Answers

Freshwater wetlands are ecosystem affected by inundation (permanently or temporary). The three major types are swamps (uncultivated low-lying ground where water collects), marshes (low-lying and waterlogged land, flooded in wet seasons or at high tide) and bogs (wet muddy ground that's too soft to support a heavy body).

Why does the body need iron ? a. Stimulates formation of of lymph b. Forms part of hemoglobin c. Prevents destruction of red blood cells d. prevent the plaque formation in arteries

Answers

The body need iron because it is a major component of hemoglobin, an important cell for the organisms that carries oxygen from the lungs to all the parts of the body, without iron the number of hemoglobin is not enough to transport oxygen and the organism can be lead to fatigue. Therefore, the correct alternative is B. forms part of hemoglobin.

A scientist claims that Elysia chlorotica, a species of sea slug, is capable of photosynthesis. Which of the following observations provides the best evidence to support the claim?1) Elysia chlorotica grows in the dark when food sources are available.2) Elysia chlorotica grows faster when exposed to light than when placed in the dark.3) Elysia chlorotica will die if not exposed to light.4) Elysia chlorotica grows when exposed to light in the absence of other food sources.

Answers

The observation which best supports the claim that Elysia chlorotica is capable of photosynthesis is number 4. The ability to photosynthesize doesn't mean it won't be able to eat other food sources when abailable, but that it will be able to survive and grow in abscense of food sources if it is exposed to light, as light is necessary to obtain the energy for the process of photosyntesis.

What is the genetic make-up of an organism?A) PhenotypeB) AllelesC) GenotypeD) DNA

Answers

Solution:

The genotype is the collection of genes of an individual, that is, it is the genetic information that a particular organism possesses. This means that in a broad sense, the term genotype refers to the genetic makeup of an organism.

We can conclude that the correct answer is:

C) Genotype

9. During which phase does the DNA make
a copy of itself?
a. prophase
b. metaphase
c. interphase
d. anaphase

Answers

Answer: A

Explanation:

!!!!

You work with the Environmental Protection Agency and are attempting todetermine hazard levels for the insurance company. Which of the followingindividuals has the lowest risk of getting cancer?A. Someone taking hormone therapyB. A smokerC. Someone infected with HPVD. Someone getting heart bypass surgery

Answers

The individual with the lowest risk of getting cancer is someone getting a heart bypass surgery. Even though surgeries have riks, cancer is not one of them, and the rest of the conditions (HPV, hormone therapy and smoking) are fact

Using the drop-down menus, identify the structures common to all cells.

Answers

Golgi apparatus menus drop-down

Cells need energy in order to perform most cellular processes. This energy is produced throughthe process of cellular respiration. Which of the following describes this process.A. water is transported into the cell to create ATP.B. sugar molecules are broken down to produce ATP.C. light is captured and used to build sugar molecules.D. carbon dioxide molecules are combined to create protein molecules.

Answers

The correct answer is B. sugar molecules are broken down to produce ATP. In cellular respiration sugars are broken down. During the process, they release energy that allows the cell to produce ATP.

What is the correct term for microbial action that converts inorganic phosphorous back into organic phosphorous?The process ofrefers to the conversion of inorganic phosphorous to organic phosphorous.

Answers

Phosphorous

Phosphorus is very important for life because it makes up important structures in animals, supporting and allowing life.

In the biogeochemical cycle, during the immobilization process, inorganic phosphorus is converted into organic phosphorus and can be absorbed by living cells in the soil.

Therefore, the name of the process that converts inorganic phosphorus into organic phosphorus is immobilization.

What’s the correct answer answer asap for brainlist

Answers

Answer:

the answer is option a

hope this helps

Answer:
A. When it gives an organism an evolutionary advantage

Explanation:
Beneficial Mutations lead to new versions of proteins that help organisms adapt to changes in their environment.
Beneficial mutations are essential for evolution to occur. They increase an organism's changes of surviving or reproducing, so they are likely to become more common over time. It is considered an evolutionary advantage because they increase the possibility of survival or representation which will help the organism evolve longer than the version without the mutation that is less likely to survive or reproduce. :)

You are examining a patient who has been in an accident. You test their motor skills and find that they can move their limbs but cannot write with a pencil and stumble often when walking. You conclude that they have damage to the part of the brain that governs fine muscle control. What area is this?A. Brain stemB. PituitaryC. Cerebral cortexD. Cerebellum

Answers

The answer is the letter D. Cerebellum- responsible for fine muscle control.

*Cerebellum is responsible for maintaining balance and posture.

What is true about the relationship between cells and the organism they are part of?
Group of answer choices

Cells make up the basic structure of an organism, and they perform basic life functions for the organism.

Cells perform basic life functions for the organism, but they do not make up the basic structure of an organism.

Cells make up the basic structure of an organism, but they do not perform basic life functions for the organism.

Cells do not make up the basic structure of an organism, and they do not perform basic life functions for the organism.

Answers

The true statement regarding the relationship between cells and organism is that cells make up the basic structure of an organism, and they perform basic life functions for the organism (option A).

What is a cell?

A cell is the basic unit of a living organism, consisting of a quantity of protoplasm surrounded by a cell membrane, which is able to synthesize proteins and replicate itself.

A cell is the basic unit of every living organisms meaning that a performs the basic function of living organisms. For example, the photosynthetic ability of a cell is a function of the chloroplast in the cell.

According to the cell theory proposed in the 1890's, which is the scientific theory that all living organisms are made of cells as the smallest functional unit, the cell is the basic functional and structural unit of living things.

Therefore, it can be said that a cell is the basic functional unit of the cell.

Learn more about cell at: https://brainly.com/question/3142913

#SPJ1

Is there any cons to the environment of living rurally ?

Answers

Living in rural environments can be difficult due to the distance from the major centers and amenities of urbanization, since the way in which the human pecies has adapted to live in a community is direct linked to technologies that are sometimes nor available in a rural region. The lack of diversity of functions can also become a hindrance, since the rural region have agricultural activities or related to agriculture as the marjor, or in some cases the only, possibility of branch of work.

To the environmental the increase in people living in a rural region is the increased comsumption and exploitation of local natural resources, as well as the urban expansion for housing construction and other infrastructures. The population growth in the region can inevitably leads to climate changes and modifications in the fauna and flora.

The element chlorine belongs to which of the following groups?
*
2 points
alkali metals
halogens
noble gases
alkaline earth metals

Answers

Answer:

hallogens

Explanation:

b/c alkali and alkaline eearth metals both are group 1 and 2 hallogens group 7 and noble gases group 8 .

Given: dna codon chart, DNA sequence.DNA sequence given is: 3’ TAC CCC GAT AAA ATA CAT TTA GGA TCG CGA TGG TAT 5’How do you transcribe the DNA sequence into mRNA?And can you underline or highlight on the sequence the codons for Proline and Tyrosineand label which is which? Thanks

Answers

Step 1:

The process of DNA transcription occurs from the 5' to 3' being the DNA sequence in the correct order for transcription as follow:

5' TAT GGT AGC GCT AGG ATT TAC ATA AAA TAG CCC CAT 3'

Step 2:

Resulting in the mRNA:

5' AUA CCA UCG CGA UCC UAA AUG UAU UUU AUC GGG GUA 3'

- Being the nucleotide thymine replaced by uracil in the formation of the RNA strand.

Step 3:

The codons sequence that form proline and tyrosine are:

Proline: CCA;

Tyrosine: UAU.

which statement best describes an example of how climate change leads to decreased biodiversity?
A. Increased rains in dry regions cause more plants to grow,
increasing the ecosystem's resiliency.
B. High temperatures become more common farther from the
equator, leading to increased stability of the ecosystem.
C. Warmer arctic regions allow for increased animal populations,
changing the ecosystem's resiliency.
0
D. Sea levels rise due to increased temperatures, flooding coastal
areas and leading to an unstable ecosystem.

Answers

The statement which best describes an example of how climate change leads to decreased biodiversity is that sea levels rise due to increased temperatures, flooding coastal areas and leading to an unstable ecosystem and is denoted as option D.

What is Ecosystem?

This is a term which consists if all organisms and their interaction with their physical environment and is affected or influenced by different types of factors such as human and environmental factors.

An example is climate change which causes sea levels to rise thereby flooding areas. It leads to loss of habitat and an unstable ecosystem which decreases the biodiversity.

Read more about Ecosystem here https://brainly.com/question/842527

#SPJ1

3. How might the changes that you identified affect the protein’s structure?Example: The change would likely have no effect. Neither valine and isoleucine would promote hydrogen bonding with water, because their R groups are nonpolar and thus hydrophobic.Changes spotted in the previous question:1. Valine changed for Isoleucine: there was not a change in the chemical properties, because both amino acids have non-polar chains2. Valine changed for Alanine: there was not a change in the chemical properties, because both amino acids have non-polar chains3. Glutamate changed for Alanine: there was a change because the aminoacidic chain lost their electronegativity4. Glutamate changed for Aspartate: there was not a change because the aminoacidic chain kept it's electronegativity.1) _______________________________________________________________2) _______________________________________________________________3) _______________________________________________________________4) _______________________________________________________________

Answers

In the previous exercise we spotted that in the sequences there were at least four changes in the aminoacidic sequences:

1. Valine changed for Isoleucine: as indicated by the very exercise, there wouldn't be a negative effect, because both amino acids have hydrophobic radical groups.

2. Valine changed for Alanine: like in the previous case, there wouldn't be a negative effect, because both amino acids have hydrophobic radical groups.

3. Glutamate changed for Alanine: there would be a change in the protein structure because Glutamate can form hydrogen bonds, and Alanine doesn't.

4. Glutamate changed for Aspartate: there wouldn't be a change in the protein structure because both amino acids can form hydrogen bonds.

Create a phylogenetic tree of the major groups of plants using green algae as the outgroup. You should include angiosperms, gymnosperms, ferns and their allies, and bryophytes making sure to provide characters on the tree indicating why lineages separated where they did.

Answers

In this case, we have the major groups of plants, many characters have defined the appearance of each group however there are some traits that are too important and those are mentioned here.

In the base is algae, when the retention of the Zygote occurs plants started to evolve when plants started to evolve in earth bryophyte came to be, however they do not possess a proper vascular system, this occurred with pteridophytes (ferns and so forth), nonetheless still produced spores, angiosperms reduced gametes and pollen came as innovation, however, they produced strobili, so the innovation of angiosperms were flowers.

True or False: Blood sugar would be lower than normal if alpha cells constantly secreted insulin.

Answers

Answer:

The human body wants blood glucose (blood sugar) maintained in a very narrow range. Insulin and glucagon are the hormones which make this happen. Both insulin and glucagon are secreted from the pancreas, and thus are referred to as pancreatic endocrine hormones. The picture on the left shows the intimate relationship both insulin and glucagon have to each other. Note that the pancreas serves as the central player in this scheme. It is the production of insulin and glucagon by the pancreas which ultimately determines if a patient has diabetes, hypoglycemia, or some other sugar problem.

Enzymes_______activation energy and______up chemical reactions.
A. lower, speed
B. speed, lower
C. lower, slow

Answers

Answer:

A: lower, speed

Explanation:

Enzymes definitely speed up chemical reactions because they are proteins that act as biological catalysts. Catalysts speed up reactions without being used up themselves. They are reusable.

Lowering the activation energy makes the reaction faster because less energy is required to do the same task.

B and C do not make sense because speed activation energy doesn't make sense and slow up doesn't make sense either.

There is a key difference between aerobic respiration (cellular respiration) and anaerobic respiration (fermentation). Explain this difference and what is the overall equation for aerobic cellular respiration.

Answers

The key difference  is that aerobic respiration requires oxygen, and anaerobic respiration does not.

Aerobic respiration in a cell is when glucose breaks down with help of oxygen and yields carbon dioxide, water, and with the release of energy. Thus end products are [tex]CO_2}[/tex] and [tex]H_{2}O[/tex] .The process of releasing energy takes a much longer time. Example it occurs in plants and animals.

Anaerobic respiration  in a cell, is the process of breaking down  glucose without the use of oxygen then it yields to the end products  [tex]CO_{2}[/tex] (carbon dioxide), alcohol and energy. It is a fast process. Example human muscle cells, and bacteria.

The equation for aerobic cellular respiration
[tex]C_{6} H_{12} O_{6} + 6O_{2}[/tex] ⇒ [tex]6CO_{2} + 6H_{2}O[/tex] + ATP(energy)
Glucose   + oxygen ⇒ carbon dioxide + water +energy.

learn more about aerobic and anaerobic respiration at
brainly.com/question/28688557

Which of the following molecules provides the greatest energy storage capacity in animal cells?
A. starch
B. proteins
C. triglycerides

Answers

Triglycerides are the molecules that provide the greatest energy storage capacity in animal cells.

What is triglycerides?

Triglycerides are the type of fat also called lipids that are found in your blood. When you eat, your body converts calories that it does not need to use into triglyceride molecules. The triglycerides are stored in the fat cells. After the hormones release triglycerides for energy between eating. Sugary food, sweat drinks, saturated fats, refined grains, alcohol, and foods having high-calorie all lead to high levels of triglycerides. The healthcare provider classifies high triglyceride levels i.e. Mild levels as 150-199 mg/dL, Moderate level has 200-499 mg/dL, and Severe levels has Greater than 500 mg/dL. Very high triglycerides may cause blocking of the blood supply to the heart or brain. Symptoms of lower blood supply to your heart could be chest pain.

So we can conclude that option C is the correct answer.

Learn more about energy here: https://brainly.com/question/13881533

#SPJ1

View the attached worksheet. On this worksheet, you will build realistic (think of the animals and plants that exist in ecosystems near you) food chains that become increasingly more complex. You will use the information on your food chains to build a food web at the very end.

Answers

Sun -> Oak- > decomposer

Sun -> eucalyptus -> koala - > decomposer

Sun -> carrot -> rabbit -> owl- > decomposer

Sun -> algae -> krill -> penguin -> seal - > decomposer

Sun -> grass -> grasshoper -> mouse -> snake- > hawk -> decomposer

watts.
6. Solve a One-Step
Equation A hair dryer is
rated at 1,200 watts. If you
use the dryer for 0.25 hours,
how much electric energy do
you use?

Answers

The electrical energy consumed is 0.3 kWh. Electrical energy is energy related to forces on electrically charged particles and electrically charged particle movement.

What is electrical energy?Electrical energy is the ability of an atom's charged particles to perform an action or move an object. Electrical energy is produced by the movement of electrons from one atom to another. When you plug in a toaster or a cellphone charger into a wall outlet, electrical energy is used to power those devices. Electricity can be either kinetic or potential.Batteries, lightning, and electrical charges moving through a wire plugged into a wall socket to power electrical appliances such as televisions and computers are all examples of electrical energy. It now even powers many of our automobiles. It can be found in the clouds above you during a storm even if you travel to the most remote parts of the planet.

Therefore,

The amount of electrical energy consumed can be calculated as follows:

E = Pt

where;

P is the power (kW)

t is time (h)

E = 1.2 kW x 0.25 h

E = 0.3 kWh

As a result, the total amount of electrical energy consumed is 0.3 kWh.

To learn more about electrical energy, refer to:

https://brainly.com/question/874116

#SPJ13

Why isn’t the mitochondria classified as part of the endomenbrame system

Answers

The endomembrane system encompasses the organelles that mediate the importa, export of molecules, that is, the transport of molecules from the environment to the cytoplasm and from the cytoplasm to the environment, respectively. The organelles that participate in such activities are the endoplasmic reticulum, the golgi apparatus, vacuoles and the cell membrane. Mithocondria's main purpose is energy production through oxidation of the carbohydrates/lipids we consume, thus, it is not related to molecule transport, and it can not be part of the endomembrane system.

Other Questions
national laws that direct state or local governments to comply with federal rules or regulations without providing funds to defray the costs are called: measurement of land section Can anyone do these In the accompanying diagram, points A, E, and B are collinear, measure of angle A= 30, measure of angle DEB= 130, and segment AB is perpendicular to segment BC. Find the measure of angle C and the measure of angle D. the difference between what the total sales should have been, given the actual level of activity for the period, and the actual total sales is a(n) variance. What is the difference between the lithosphere and asthenosphere that makes up the mantle The ship leaves at 18 40 to sail to the next port.It sails 270 km at an average speed of 32.4 km/hFind the time when the ship arrives. true or false 16/24 equals 30 / 45 Which line best helps develop the central idea that the plague was almost impossible for elizabethans to survive?. What does ceteris paribus mean? I don't get any of this help me please Gary applied the distributive property using the greatest common factor to determine the expression that is equivalent to 66 + 36. His work is shown below.Factors of 66: 1, 2, 3, 6, 11, 22, 33, 66Factors of 36: 1, 2, 3, 4, 6, 9, 12, 18, 3666 + 36 = 3 (22 + 12)What statement best describes Garys error?Gary did not use correct factors for 66 in the equation.Gary did not use correct factors for 36 in the equation.Gary did not use two equivalent expressions in the equation.Gary did not use the greatest common factor in the equation. pls hurry 10 mins left Find the missing quantity with the information given. Round rates to the nearest whole percent and dollar amounts to the nearest cent% markdown = 40Reduced price = $144$ markdown = ? THIS IS URGENT A line includes the points (2,10) and (9,5). What is its equation in point-slope form?Use one of the specified points in your equation. Write your answer using integers, proper fractions, and improper fractions. Simplify all fractions. Radicals and Exponents Identify the choices that best completes the questions 3. which theory of international relations would be most likely to expect an international organization such as the united nations to get involved in an international incident because of human rights violations? Can you help me pls with the answers A 46 gram sample of a substance that's a by product of fireworks has a k-value of 0.1394. Find the substance's half-life in days. Round your answer to the nearest tenth.N=N0e^-kt Jason is making bookmarks to sell to raise money for the local youth center. He has 29 yards of ribbon, and he plans to make 200 bookmarks.Approximately how long is each bookmark, in centimeters? liquid octane will react with gaseous oxygen to produce gaseous carbon dioxide and gaseous water . suppose 3.4 g of octane is mixed with 20.5 g of oxygen. calculate the minimum mass of octane that could be left over by the chemical reaction. be sure your answer has the correct number of significant digits.