I need help plz and thank you this is due

Physical Education

Soccer
Assignment Directions:

Research three of the world’s most famous soccer players. Compose a brief visual presentation using PowerPoint to present each player and their accomplishments.

Your presentation should reflect your understanding of the sport as well as the athletic ability needed to be successful.

Assignment Guidelines:

Your presentation should include elements of:
• Childhood
• Work ethic
• Hardships
• Examples from games
• Terminology consistent with the sport

Submission Requirements:

Submit your presentation

When submitting written assignments please remember to:
• Submit the assignment question(s) and your responses.
• Proof-read for spelling, grammar, and punctuation.
• Remember complete sentence structure.
• Paragraphs need to have a minimum of six sentences.

Answers

Answer 1

Answer:

hello ...i have a question do u want the presentation completed by the person who is going to answer this question


Related Questions

please help fill in the blank Earth’s axis passes through the (blank) and south poles.

Answers

Answer:

North

Explanation:

Have a nice day :)

Which activity would help maintain homeostasis during exercise?


increasing the amount of water excreted from the kidneys


decreasing the heart rate


developing goose bumps on the skin


speeding up the rate of breathing

Answers

Decreasing heart rate

Answer:

Speeding up the rate if breathing

Explanation:

The more and quicker you breathe, the more oxygen your cells get

Rahim is watching his favorite football team on television. In order to work, the television must be plugged into an electrical outlet. When the television gets turned on, what is the main energy transformation demonstrated by the television?? heres the answer choices A. heat energy into electrical energy
B. electrical energy into heat energy
C. electrical energy into light energy
D. light energy into electrical energy

Answers

I think the answer is B
Answer:

C.) electrical energy into light energy


Explanation;

The television produces light energy by transforming electrical energy into light energy. Light energy comes from the vibration of electrically charged particles.

Hope this helps :)

Roxanne is an expert at blowing bubbles with bubble gum. She discovered that her bubbles were bigger if she stood facing the Sun when she blew them. At lunch she told her three best friends about her discovery and after school they all tried it. No one else was able to blow bigger bubbles when they faced toward the Sun. Which of the following would be best for Roxanne to do next? A. She should prove she is right by blowing bubbles while her friends are watching.
B. She should give them each bigger pieces of bubble gum and try it one more time.
C. She should think about what else she is doing that might have made the bubbles bigger.
D. She should ask her friends to try it again and concentrate harder when they face the Sun.

Answers

Answer:

My guess is C

Explanation:

Which actions are essential to active participation? Check all that apply.

taking control
coming prepared
being focused
keeping quiet
assisting others
asking questions

Answers

Answer:

2, 3, 4, 6.

Explanation:

The actions which are essential for active participation are coming prepared, being focused, keeping quiet, and asking questions so, options B, C, D, and F are correct.

What is active participation?

In order to make wise decisions and actively and positively participate in the democratic cultures, they live in, citizens must possess the competencies that active participation calls for. These competencies include a level of awareness of oneself in relation to the environments into which they are thrust.

The fundamental tenets of active participation include promoting an individual's rights, choices, and independence. The cornerstone of person-centered care, which respects a person's dignity, values, and freedom to choose and make decisions in accordance with their unique needs and beliefs, is also these concepts.

To know more about active participation:

https://brainly.com/question/15207059

#SPJ2

Help again i need it quick

Answers

Answer:

it seems that the answer should be 7.5 mph as the average

Explanation:

sorry i did (s x t) when it was (s/t)

Answer:

15mph

Explanation:

Hope this helps

Other Questions
Connections Academy Geometry10A semester exam. Does anyone have the answers im 1% away from passing. d)Rajendra is visiting to his uncle. (simple present tense) 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? Step 4: Is the function increasing or decreasing? Why?-It is increasing because the graph line points down and right and has a positive slope.-It is decreasing because the graph line points down and right and has a negative slope.-It is decreasing because the graph line points up and right and has a negative slope.-The function is neither increasing nor decreasing.-It is increasing because the graph line points up and right and has a positive slope. 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs.