Find the 7th term of the geometric sequence –4, 12, –36, 108, –324,...
a
–2,916
b
972
c
8,748
d
–2,920

Answers

Answer 1

Answer:

a

Step-by-step explanation:

a=-4 r=12/-4=-3

T7= ar^n-1

= (-4)(-3)^7-1

=-2916

Answer 2

The first term of this geometric sequence is equal to: A. -2916.

How to calculate the 7th term of a geometric sequence?

Mathematically, a geometric sequence is given by this expression:

[tex]a_n =a_1r^{n-1}[/tex]

Where:

r is the common ratio.a is the first term of a geometric sequence.

Based on the geometric sequence, the first term is equal to -4. Also, the common ratio is given by:

r = 12/-4

r = -3.

For the 7th term, we have:

a₇ = -4 × (-3)⁷⁻¹

a₇ = -4 × (-3)⁶

a₇ = -4 × 729

a₇ = -2916.

Read more on geometric sequence here: brainly.com/question/12630565

#SPJ2


Related Questions

Write the given trinomial if possible as a square of a binomial or as an expression opposite to a square of a binomial: 15ab-9a^2-6 1/4b^2

Answers

Answer:

[tex] - \bigg(3a - \frac{5}{2} b) \bigg)^{2} [/tex]

Step-by-step explanation:

[tex]15ab-9a^2-6 \frac{1}{4} b^2 \\ \\ = 15ab-(3a)^2-\frac{6 \times 4 + 1}{4} b^2 \\ \\ = 15ab-(3a)^2-\frac{24+ 1}{4} b^2 \\ \\ = 15ab-(3a)^2-\frac{25}{4} b^2 \\ \\ = 15ab- (3a)^2- \bigg(\frac{5}{2} b \bigg)^2 \\ \\ = - \{ - 15ab + (3a)^2 + \bigg(\frac{5}{2} b \bigg)^2 \} \\ \\ = - \{ (3a)^2 + \bigg(\frac{5}{2} b \bigg)^2 - 15ab \} \\ \\ = - \bigg(3a - \frac{5}{2} b \bigg)^{2} [/tex]

The measure of angel B is (3x - 4)º and the measure of angel D is (2x - 6)°. What are the measures of angles B and D?​

Answers

Answer:

b=110 d=70

Step-by-step explanation:

Answer:

110 70

Step-by-step explanation:

Determine the slope and y-intercept of the line.
y = -69x - 346
a.
Slope = -346, y-intercept is (0, -69)
c.
Slope = -69, y-intercept is (0, -346)
b.
Slope = 69, y-intercept is (0, -346)
d.
Slope = -346, y-intercept is (0, 69)

Answers

Answer:

Slope = -69, y-intercept is (0, -346)

Step-by-step explanation:

y=-69x-346

x=0

y= -69(0)-346

y=0-346

y=0

sople -69 coefficient of x

Answer:

c

Step-by-step explanation:

pls help i have pictures pls explain how you get your answer

Answers

Slope: (y2-y1)/(x2-x1)
The points: (0,-5) (4,-2)
(-2 + 5)/(4-0) = 3/4
The slope is 3/4

Another way to do it is rise/run
Draw a triangle from the two points
The vertical is rise, horizontal is run
3 units over 4 units
The slope is confirmed 3/4

Answer:

0.75

Step-by-step explanation:

To find the slope of the graph, you have to find the rise and the run by any two points on the graph. (I'm going to calculate using the two blue dots as shown in the picture)

[tex]\frac{rise}{run}[/tex] = [tex]\frac{(-2)-(-5)}{4-0}[/tex]

           = [tex]\frac{-2+5}{4}[/tex]

           = [tex]\frac{3}{4}[/tex]

           = 0.75

Graph the line with the equation y=-1/4x+1

Answers

On the y axis plot a point at 1. Then go down 1 and to the right 4. Hope that helps

A single fair die is tossed. Find the odds in favor of rolling a number greater than 5

What are the odds in favor of rolling a number greater than 5?

Please help

Answers

Answer:

[tex]1 : 5\ or\ \frac{1}5[/tex]

Step-by-step explanation:

Given that:

A single fair die is tossed.

First of all, let us learn about a fair die.

A fair die is a 6 sided die numbered from 1, 2, 3, to 6 and each side has an equal probability of occurring OR we can say each side is equally likely to occur.

So, probability of rolling a number greater than 5 has only one possible outcome i.e. 6.

And total number of outcomes are 6.

So, probability of rolling a number greater than 5 = [tex]\frac{1}{6}[/tex]

Probability of not rolling a number greater than 5 = [tex]\frac{5}{6}[/tex]

Odds in favor of rolling a number greater than 5 = Probability of rolling a number greater than 5 : Probability of not rolling a number greater than 5

[tex]\dfrac{1}{6} :\dfrac{5}{6} = \bold{1:5}\ or\ \bold{\dfrac{1}{5}}[/tex]

Using the probability concept, the odds of rolling a number greater than 5 is 1 :5

The odd of a particular experiment is defined thus :

Number of possible outcomes greater than 5 : number of possible below or equal to 5

Sample space = {1, 2, 3, 4, 5, 6}

Outcomes greater than 5 = {6} = 1

Outcomes below or equal to 5 = {1, 2, 3, 4, 5} = 5

The odds equals to 1 : 5

Learn more : https://brainly.com/question/20388678

Solve the system of equations.



−2x+5y =−35
7x+2y =25

Answers

Answer:

The equations have one solution at (5, -5).

Step-by-step explanation:

We are given a system of equations:

[tex]\displaystyle{\left \{ {{-2x+5y=-35} \atop {7x+2y=25}} \right.}[/tex]

This system of equations can be solved in three different ways:

Graphing the equations (method used)Substituting values into the equationsEliminating variables from the equations

Graphing the Equations

We need to solve each equation and place it in slope-intercept form first. Slope-intercept form is [tex]\text{y = mx + b}[/tex].

Equation 1 is [tex]-2x+5y = -35[/tex]. We need to isolate y.

[tex]\displaystyle{-2x + 5y = -35}\\\\5y = 2x - 35\\\\\frac{5y}{5} = \frac{2x - 35}{5}\\\\y = \frac{2}{5}x - 7[/tex]

Equation 1 is now [tex]y=\frac{2}{5}x-7[/tex].

Equation 2 also needs y to be isolated.

[tex]\displaystyle{7x+2y=25}\\\\2y=-7x+25\\\\\frac{2y}{2}=\frac{-7x+25}{2}\\\\y = -\frac{7}{2}x + \frac{25}{2}[/tex]

Equation 2 is now [tex]y=-\frac{7}{2}x+\frac{25}{2}[/tex].

Now, we can graph both of these using a data table and plotting points on the graph. If the two lines intersect at a point, this is a solution for the system of equations.

The table below has unsolved y-values - we need to insert the value of x and solve for y and input these values in the table.

[tex]\begin{array}{|c|c|} \cline{1-2} \textbf{x} & \textbf{y} \\ \cline{1-2} 0 & a \\ \cline{1-2} 1 & b \\ \cline{1-2} 2 & c \\ \cline{1-2} 3 & d \\ \cline{1-2} 4 & e \\ \cline{1-2} 5 & f \\ \cline{1-2} \end{array}[/tex]

[tex]\bullet \ \text{For x = 0,}[/tex]

[tex]\displaystyle{y = \frac{2}{5}(0) - 7}\\\\y = 0 - 7\\\\y = -7[/tex]

[tex]\bullet \ \text{For x = 1,}[/tex]

[tex]\displaystyle{y=\frac{2}{5}(1)-7}\\\\y=\frac{2}{5}-7\\\\y = -\frac{33}{5}[/tex]

[tex]\bullet \ \text{For x = 2,}[/tex]

[tex]\displaystyle{y=\frac{2}{5}(2)-7}\\\\y = \frac{4}{5}-7\\\\y = -\frac{31}{5}[/tex]

[tex]\bullet \ \text{For x = 3,}[/tex]

[tex]\displaystyle{y=\frac{2}{5}(3)-7}\\\\y= \frac{6}{5}-7\\\\y=-\frac{29}{5}[/tex]

[tex]\bullet \ \text{For x = 4,}[/tex]

[tex]\displaystyle{y=\frac{2}{5}(4)-7}\\\\y = \frac{8}{5}-7\\\\y=-\frac{27}{5}[/tex]

[tex]\bullet \ \text{For x = 5,}[/tex]

[tex]\displaystyle{y=\frac{2}{5}(5)-7}\\\\y=2-7\\\\y=-5[/tex]

Now, we can place these values in our table.

[tex]\begin{array}{|c|c|} \cline{1-2} \textbf{x} & \textbf{y} \\ \cline{1-2} 0 & -7 \\ \cline{1-2} 1 & -33/5 \\ \cline{1-2} 2 & -31/5 \\ \cline{1-2} 3 & -29/5 \\ \cline{1-2} 4 & -27/5 \\ \cline{1-2} 5 & -5 \\ \cline{1-2} \end{array}[/tex]

As we can see in our table, the rate of decrease is [tex]-\frac{2}{5}[/tex]. In case we need to determine more values, we can easily either replace x with a new value in the equation or just subtract [tex]-\frac{2}{5}[/tex] from the previous value.

For Equation 2, we need to use the same process. Equation 2 has been resolved to be [tex]y=-\frac{7}{2}x+\frac{25}{2}[/tex]. Therefore, we just use the same process as before to solve for the values.

[tex]\bullet \ \text{For x = 0,}[/tex]

[tex]\displaystyle{y=-\frac{7}{2}(0)+\frac{25}{2}}\\\\y = 0 + \frac{25}{2}\\\\y = \frac{25}{2}[/tex]

[tex]\bullet \ \text{For x = 1,}[/tex]

[tex]\displaystyle{y=-\frac{7}{2}(1)+\frac{25}{2}}\\\\y = -\frac{7}{2} + \frac{25}{2}\\\\y = 9[/tex]

[tex]\bullet \ \text{For x = 2,}[/tex]

[tex]\displaystyle{y=-\frac{7}{2}(2)+\frac{25}{2}}\\\\y = -7+\frac{25}{2}\\\\y = \frac{11}{2}[/tex]

[tex]\bullet \ \text{For x = 3,}[/tex]

[tex]\displaystyle{y=-\frac{7}{2}(3)+\frac{25}{2}}\\\\y = -\frac{21}{2}+\frac{25}{2}\\\\y = 2[/tex]

[tex]\bullet \ \text{For x = 4,}[/tex]

[tex]\displaystyle{y=-\frac{7}{2}(4)+\frac{25}{2}}\\\\y=-14+\frac{25}{2}\\\\y = -\frac{3}{2}[/tex]

[tex]\bullet \ \text{For x = 5,}[/tex]

[tex]\displaystyle{y=-\frac{7}{2}(5)+\frac{25}{2}}\\\\y = -\frac{35}{2}+\frac{25}{2}\\\\y = -5[/tex]

And now, we place these values into the table.

[tex]\begin{array}{|c|c|} \cline{1-2} \textbf{x} & \textbf{y} \\ \cline{1-2} 0 & 25/2 \\ \cline{1-2} 1 & 9 \\ \cline{1-2} 2 & 11/2 \\ \cline{1-2} 3 & 2 \\ \cline{1-2} 4 & -3/2 \\ \cline{1-2} 5 & -5 \\ \cline{1-2} \end{array}[/tex]

When we compare our two tables, we can see that we have one similarity - the points are the same at x = 5.

Equation 1                  Equation 2

[tex]\begin{array}{|c|c|} \cline{1-2} \textbf{x} & \textbf{y} \\ \cline{1-2} 0 & -7 \\ \cline{1-2} 1 & -33/5 \\ \cline{1-2} 2 & -31/5 \\ \cline{1-2} 3 & -29/5 \\ \cline{1-2} 4 & -27/5 \\ \cline{1-2} 5 & -5 \\ \cline{1-2} \end{array}[/tex]                 [tex]\begin{array}{|c|c|} \cline{1-2} \textbf{x} & \textbf{y} \\ \cline{1-2} 0 & 25/2 \\ \cline{1-2} 1 & 9 \\ \cline{1-2} 2 & 11/2 \\ \cline{1-2} 3 & 2 \\ \cline{1-2} 4 & -3/2 \\ \cline{1-2} 5 & -5 \\ \cline{1-2} \end{array}[/tex]

Therefore, using this data, we have one solution at (5, -5).

If a farmer is able to get 120 eggs from 20 chickens, how many eggs is the farmer able to get per chicken?

Answers

Answer:

6 eggs per chicken

Step-by-step explanation:

hdjdjidbdudbddjow0s

Answer:

6

Step-by-step explanation:

What is the value of a? Please solve this with the law of sine

Answers

Answer:

what chap is this

Step-by-step explanation:

Which is the better buy?
7-pound bag of barley for $6.72
312-ounce bag of barley for $28.08

Answers

Answer:

7-pound bag of barley for $6.72 is a better buy.

Step-by-step explanation:

7-pound bag of barley for $6.72

6.72 : 7 = 0.96

check your work: 0.96 x 7 = 6.72

so for the first offer you will be paying $0.96 per pound

312-ounce bag of barley for $28.08

1 pound = 16 ounces

312 ounces = 19.5 pounds

28.08 : 19.5 = 1.44

for the second offer you will be paying $1.44 per pound of barley. 7-pound bag of barley for $6.72 is a better buy because you will be less for each pound.

hope this helps!

Answer:

7-pound bag of barley for $6.72

Step-by-step explanation:

What is the equation in slope-intercept from of the line that passes through the point (3, 1) and is parallel to the line represented by y = 2.4x + 6.5?

Answers

Parallel = same slope
Y = 2.4x + b
Plug in the point to find b
1 = 2.4(3) + b
1 = 7.2 + b
b = -6.2
Final equation: y = 2.4x - 6.2

Easy 6th grade question for 25 points.
Reed uses 8 pieces of glass per square foot to make a stained glass window.

How many pieces of glass will he need to make a window that is 864 square inches?

Answers

Answer:

Answer is 576. divide 864 by 12 because 12 inches is a foot and then you'll get 72 and then you multiple that by 8.

What is i2=-1 math test

Answers

Answer:

Your answer is: ↓

If your converting in Logarithmic Form then your answer is: [tex]log_{i}(-1)=2[/tex]

If you are trying to figure if that equation is determined T/F: The answer is T.

If you are trying to evaluate (expand) the question your answer is:[tex]-1=-1[/tex]

Step-by-step explanation:

Hope this helped : )

What is the cube root of 512m^12n^15?
-16m^4n^5
-8m^5n^4
8m^4n^5
16m^5n^4

Answers

Answer: 8m ^ 4n ^ 5

Find the LCD of the two fractions 1/6 and 1/5

A. 6

B. 5

C. 30

D. 11

Answers

Answer:

C. 30 is the correct answer.

Step-by-step explanation:

Im only have 10 minutes please. Is math​

Answers

Answer: A
Explanation do Pythagorean theorem and find the third side. Then do adjacent/hypotenuse.
Darling, it’s A. Have noice night/ day

Johnny made 8 benches in 2 hours. At this rate, how
many benches will he make in 9 hours.



plzzzzzzzzzz!!!!!!!! help on thissss

Answers

Answer:

36

Step-by-step explanation:

4 benches in 1 hour

? benches in 9 hours

36 benches

HOPE THIS HELPS

PLZZ MARK BRAINLIEST

Answer:

36 is the answer :)

Step-by-step explanation:

What is the solution to the system: ax+y=18 and 4ax-y=12? Use elimination. Put the answer as an ordered pair. Show work on the next question. You have 3 unknowns and only 2 equations so you can have the variable "a" in your solution

Answers

Answer:

Ax=6

Y=12

Therefore a=6, x=1, y=12

Answer:

{([tex]\frac{6}{a}[/tex],12)}

Step-by-step explanation:

[tex]\left \{ {{ax+y=18} \atop {4ax-y=12}} \right.[/tex]

[tex]5ax = 30[/tex]

[tex]x = \frac{6}{a}[/tex]

[tex]a(\frac{6}{a}) + y = 18[/tex]

6 + y =18→y=12

[tex]4a(\frac{6}{a}) - 12 = 12[/tex]

6 - 12 = 12 → 12 = 12 true  x=[tex]\frac{6}{a}[/tex]  y=12

what is the image of (6,-6) after a dilation by a scale factor of 4 centered at the origin

Answers

9514 1404 393

Answer:

  (24, -24)

Step-by-step explanation:

Dilation centered at the origin multiplies each coordinate by the dilation factor.

  image = 4 × (6, -6)

  image = (24, -24)

What is 0.62x10 yo the power of 3

Answers

Answer:

62

Step-by-step explanation:

Answer:

238.328

Step-by-step explanation:

The product of 0.62 x 10 is 6.2. So, I did 6.2 to the power of 3, which is 238.328.

Emile is a long-distance runner. He runs at a constant speed of six miles/hour. His goal is to run nine miles on each practice run, but he normally runs a distance that varies three miles more or less than that. Select the correct answer from each drop-down menu. The equation that can be used to find the minimum and maximum time (in hours) Emile runs is_____. For each practice run, the minimum number of hours Emile runs is______ and the maximum number of hours he runs is ______.

Answers

Answer:

[tex]t=\dfrac{9\pm 3}{6}[/tex]

[tex]1\ \text{hour}[/tex]

[tex]2\ \text{hour}[/tex]

Step-by-step explanation:

s = Speed of Emile = 6 miles/hour

d = Distance traveled by Emile = [tex](9\pm 3)\ \text{miles}[/tex]

Time taken to find the minimum and maximum time Emile ran for is

[tex]t=\dfrac{d}{s}\\\Rightarrow t=\dfrac{9\pm 3}{6}[/tex]

The required equation is [tex]t=\dfrac{9\pm 3}{6}[/tex]

The time taken is

[tex]t=\dfrac{9-3}{6}\\\Rightarrow t=\dfrac{6}{6}\\\Rightarrow t=1\ \text{hour}[/tex]

The minimum number of hours Emile runs is 1 hour.

[tex]t=\dfrac{9+3}{6}\\\Rightarrow t=\dfrac{12}{6}\\\Rightarrow t=2\ \text{hour}[/tex]

The maximum number of hours Emile runs is [tex]2\ \text{hour}[/tex].

Answer:

|6x – 9| = 3

1 Hour

2 Hours

Step-by-step explanation:

The equation that can be used to find the minimum and maximum time (in hours) Emile runs is_|6x – 9|= 3_. For each practice run, the minimum number of hours Emile runs is__1 hour_ and the maximum number of hours he runs is _2 hour.

Sum of 5 and 9 less than 17

Answers

Answer:

15?

Step-by-step explanation:

Answer:

-3

Step-by-step explanation:

5+9=14

14-17=-3

In what quadrant of the complex plane is -30-40i

Answers

Quadrant 3. You go 30 to the left and 40 down

What is the result of 4 divided by one-half? A number line going from 0 to 4. 2 8 12 16

Answers

Answer:

2

4/.5 = 2

Therefore, your answer is 2, or A. Hope this helped!

Answer:

the answer is B) 8

Step-by-step explanation:

hope this helped sorry if it didn't and if it's wrong sorry for that also.

Write an
equation in slope-intercept form of the line that passes through the
points (-5, -11) and (6,11).

Answers

Answer:

Slope=2.

Step-by-step explanation:

Slope=y1-y2/x1-x2

Where

X1,y1,=(-5, -11) X2,y2=(6,11).

Slope=-11-11/-5-6

=-22/-11

=22/11

=2

Slope is 2

Answer:

2

Step-by-step explanation:

Here,

x₁ = (- 5) and x₂ = 6

y₁ = (- 11) and y₂ = 11

Now,

Slope

= y₁ - y₂ ÷ x₁ - x₂

= (- 11) - ( 11) ÷ (- 5) - ( 6 )

= - 11 - 11 ÷ - 5 - 6

= - 22 ÷ - 11

= 2 ÷ 1 = 2

Thus, Slope is 2

-TheUnknownScientist

12% of ___ shirts is 36 shirts

Answers

Answer: 3

Step-by-step explanation:

Answer:

300 shirts

Step-by-step explanation:

You can divide 12% by itself to find one percent, then divide the 36 shirts by 12 as well.

What you do to one side, you need to do to the other.

Now that we have our numbers after dividing (you should have 1% and 3 shirts) you can see what 100% would be. To do this you would multiply 1% by 100 and multiply 3 shirts by 100.

Now we know that 12% of 300 shirts is 36 shirts.

Ryanne is 14. Her brother’s age is three more than half her age. How old is her brother?

Answers

Answer:

Her brother is 10 years old

Step-by-step explanation:

14 ÷ 2 = 7

7 + 3 = 10

The answer is 10


I need the missing length help (10 points )

Answers

Answer:

5.38516480713

Step-by-step explanation:

a^2+b^2=c^2

5^2+2^2=c^2

25+4=c^2

c^2=square root of 29

c=5.38516480713

What is the quotient in simplest form?

Three-fourths divided by StartFraction 5 Over 16 EndFraction
StartFraction 15 Over 64 EndFraction
StartFraction 15 Over 16 EndFraction
2 and two-fifths
2 and StartFraction 8 Over 20 EndFraction

Answers

Answer:

2 and 2/5

Step-by-step explanation:

Trust me on this, also can I have brainlest please? Hope you do well!

2 and two fifths i took the test 6 years ago

If x = 3 + 2√2, then the value of (x - 1/x) is

a) 4√2
b) 2√4
c) 8

Answers

Your answer is: A. 4/2

Hope this helps and happy holidays!!
Other Questions
Order the following integers from least to greatest -25,-41,36,28,and16 SOMEONE PLZ HELP ME WITH THIS?!?!? What does r-a-c-e mean How to do this question plz answer me 1. Adjacent angles are two angles in the same plane with a commonand a commonbut no common interior points. Which item most likely symbolizes danger?O A. A lightning stormB. A lightbulbO C. A four-leaf cloverO D. A snake In 1792 the radicals took control of the Assembly, abolished the monarchy, and A.) Rejected the constitutional governmentB.) Declared France a republicC.) Surrendered to the Prussian ArmyD.) Ended the war with the other nations of Europe why did Naacp support lawsuits against public institutions such as university of oklahoma? how did these lawsuits realated to the issue of intergation Who are most likely the suspects Steve refers to in the following passage (Paragraph 24)?STEVE. Go ahead, whats my wife said? Lets get it all out. Lets pick out every idiosyncrasy of every man, woman, and child on the street. And then we might as well set up some kind of kangaroo court. How about a firing squad at dawn, Charlie, so we can get rid of all the suspects? Narrow them down. Make it easier for you.A. Neighbors who appear different from other neighborsB. Criminals who have been caught in the neighborhoodC. City officials that control the neighbors lightsD. A family that moves into a new house paragraph on water cycle Recent research by Ravizza and colleagues suggests that students may spend as much as one-typical class hour browsing the internet.halfthirdfifthquarterNeed help on this question? Help me ASAP please Extending voting rights to include more groups of citizens has made the United States more? Solve the system of equations algebraically.5x - 3y = 66x - 4y = 2a. many solutionsC.no solutionb. (8, 14d. (9. 13)Please select the best answer from the choices provided A skier rides horizontally off of a 200 meter high cliff. If he lands 25 meters away from the base of the cliff, how fast was he skiing as he went off the edge?A. 0.91 m/sB. 2.91 m/sC. 3.91 m/sD. 25.91 m/s write the short note on durable and non durable materials The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question Two cards are drawn in succession from a standard 52-card deck.1. What is the probability that the first card is red and the second card is black(A) If the cards are drawn without replacement?(B) If the cards are drawn with replacement?2. Two balls are drawn in succession out of a box containing 3 red and 5 white balls. Find the probability that at least 1 ball was red, given that the first ball was(A) Replaced before the second draw(B) Not replaced before the second drawContext Header: Conditional ProbabilityContext Section:Conditional Probability is a calculation of the likelihood of an occurrence provided that another event has already occurred. Conditional probability A provided B is generally written as:P(A/B)=P(AB)P(B) Isabel company offers other programs and incentives to help employees with their savings and expenses. To be tilted to the side is? in art/dance class