The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.

5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question

Answers

Answer 1

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.


Related Questions

What is the estimated age of Earth?
A.4.6x10^6
B.4.6x10^7
C.4.6x10^8
D.4.6x10^9

Answers

Answer:

D: 4.6 x [tex]10^{9}[/tex]

Explanation:

4.6 x 10^{9} = 4,600,000,000

Earth is approximately, 4.6 billion = 4,600,000,000 = 4.6 x 10^{9}

The estimated age of Earth is 4.6x10⁹ years (D).

Scientists estimate the age of Earth through various methods, including radiometric dating of rocks and minerals. By analyzing the isotopes present in rocks and minerals, scientists can determine the decay rates of radioactive isotopes and calculate the time since the formation of those rocks.

Based on extensive studies and evidence, the current estimated age of Earth is approximately 4.6 billion years (4.6x10^9 years). This estimation is supported by multiple lines of evidence, including radiometric dating of rocks from different geological formations, lunar samples brought back from the Moon, and meteorites.

The age of 4.6 billion years is consistent with the age of the oldest rocks found on Earth's surface and the ages of the Moon and meteorites, which are believed to have formed around the same time as Earth. These dating methods provide a reliable framework for understanding Earth's geological history and the processes that have shaped our planet over billions of years.

It's important to note that scientific estimates and understanding of Earth's age continue to evolve as new evidence and research emerge. However, the current consensus among scientists is that the age of Earth is approximately 4.6 billion years, as indicated by extensive geological and radiometric dating studies.

To learn more about Earth, here

https://brainly.com/question/31064851
#SPJ2

A researcher is investigating the of effects a chemical that makes thylakoid membranes permeable to hydrogen ions (H+). Which of the following is most likely direct effectof adding the chemical to plant cells?

Answers

Answer:

B. The chloroplasts will generate less ATP

Explanation:

Photosynthesis, occurs in the chloroplasts of plants. Solar energy is converted into chemical energy in the form of stable carbohydrates.  

              6 CO2 + 6 H2O + light  →  C6H12O6 + 6 O2

Carbon Dioxide + Water + Light       Glucose + Oxygen

Chloroplasts, are small membrane-bound organelles of multi-folded membranes containing pigments, enzymes, and other molecules that facilitate the process. The thylakoid contains multiple folded membranes called granum stacked together. They contain light-absorbing pigments like chlorophyll.  

Here, absorbed light is  used in photolysis, to split water produce H+, O2 and high-energy electrons for the high-energy producing electron transport chain.  

Protons are pumped into the stroma within granum, producing ATP.                 ∴ Without ATPase, less ATP is produced.

Chloroplasts are the membrane-bound organelles, which carry out the process of photosynthesis. The correct answer is:

Option B. The chloroplasts will generate less ATP.

Photosynthesis is the process of preparing the food in presence of sunlight. It occurs in the plant. The chloroplasts are the membrane-bound organelles, which consists of pigments, enzymes, and other molecules. The thylakoid membrane consist of stacked membranes, known as grana. The light-absorbing pigment, chlorophyll is found in grana.

The following points can be used to explain photosynthesis:

The absorbed light initiates photolysis, which is the breakdown of water molecule into hydrogen and oxygen. During photolysis, high-energy electrons are also released. These electrons are utilised in the electron transport chain to provide energy.

Therefore, the permeability of the protons into the granum will yield ATP. The less ATP will be produced without ATPase.

To know more about of ATP's, refer to the following link:

https://brainly.com/question/16892068?referrer=searchResults

In which structure would you expect to find a chloroplast?
A. Blood cell from a dog
B. Cell from sunflower leaf
C. Human skin cell
D. Liver cell from a penguin

Answers

Answer:

b.cell from a sunflower leaf

The structure that can have chloroplast is the cell from sunflower leaf. The correct option is B.

What is chloroplast?

Chloroplasts are chlorophyll-containing organelles found in plant cells; they are necessary for Earth life because photosynthesis occurs in chloroplasts.

Proplastids give rise to chloroplasts, as do chromoplasts, leucoplasts, as well as other plastids.

Chloroplasts are plant cell organelles that use photosynthetic energy to convert light energy into reasonably stable chemical energy.

They survive life on Earth by doing so. Chloroplasts also perform a variety of metabolic functions for plant cells, such as the generation of fatty acids and membrane lipids.

Chloroplasts are found in all green plants and algae. Chloroplasts can also be found in photosynthesis that don't appear green, such as giant kelp's brown blades or certain plants' red leaves.

Thus, the correct option is B.

For more details regarding chloroplast, visit:

https://brainly.com/question/11136550

#SPJ6

7
1 Point)
I
what kind of angle is this?

Answers

straight angel i think

Prokaryotic cells are surrounded by a cell membrane.
True
False

Answers

Answer:

True

Explanation:

They are surrounded by a plasma membrane.

Which of these is NOT part of the digestive system?
pancreas medulla
teeth
small intestine

Answers

The answer is going to be “pancreas”. Hope this helps ! :)

Electrical energy is:

the energy form originated by electromagnetic waves or fields
the energy type due to the movement of electrons
the energy form which is present in vibrations of air

Answers

Answer:

The energy form originated by electromagnetic waves or fields.

2. The experiment proceeded as normal, with the experimental group hearing about the
potential presence of a gun as the confederates left the study and the control group not
hearing about the gun. All participants returned on day two for the interview with the
police detective. After debriefing, none of the participants said they were aware that the
theft was staged. The researchers found that those in the experimental group did
incorporate the gun misinformation into their memories of the theft more than those in
the control condition. That is, the mean score that a gun was present was much higher for
the experimental group (M= 67%, SD = 12.4%) than the control group (M= 33%, SD =
11.16%).
a. Maturation
b. Regression to the mean
c. Selection
d. Mortality
e. Instrumentation
f. Testing
mibog. History and internet
nobno h. Interactions on
brod i Diffusion location online
hodi j. No Threat
to God
092 ods

Answers

Answer:

dandruff

Explanation:

tt mm mt mm bb mm mm mk m me mm mm mm mm mm mm mm mm mm mm mm mm mm mm Jenn me mm mm! can me mm mm mm mm mm Jenn! fm meet me mama my m Mannheim momma can cannot no my mom no mm mm mm m mm mm mm mm

minn Ann mk mk mm mm mm mm mm e mm mm mm mm mm m mm mm mm mm

Answer:

dandruff

Explanation:

tt mm mt mm bb mm mm mk m me mm mm mm mm mm mm mm mm mm mm mm mm mm mm Jenn me mm mm! can me mm mm mm mm mm Jenn! fm meet me mama my m Mannheim momma can cannot no my mom no mm mm mm m mm mm mm mm

minn Ann mk mk mm mm mm mm mm e mm mm mm mm mm m mm mm mm mm

On a pH scale water is located at 7, hydrochloric acid (HCl) is located below 7 and sodium hydroxide (NaOH) is located above 7.
Group of answer choices

True

False

Answers

it is true i’ve had this on my test before

please give brainliest i wanna reach next rank

thanks!!

When would the carrying capacity of an area be most likely to change?

when resources remain the same


after a fire or flood


if emigration takes place

for all species at the same time

Answers

Answer:

Required Answer:-

An increase in population, resources, natural disasters, and catastrophic events. Weather, natural disaster, human activity. As a population reaches its carrying capacity, resources become more scarce.


hey ! can anyone help me ?!?? PLEASEE ?!?

Answers

Aquaculture: Provides additional food while avoiding over-fishing the natural habitats.

Organic Farming: Some studies have shown that the foods have more nutrients.

Sustainable Agriculture: Reduces pests, replenish’s plants nutrients, and enhances the soils quality.

Industrial Agriculture: Was designed to meet the be needs of a growing world population.

I wasn’t too sure about “Sustainable Agriculture”, and, “Organic Agriculture” but with some research and general knowledge I am pretty sure I answered them correctly.

I hope this is correct and that this helps you! :)

Helppp I will marke u as brainlest .


Muscles worksheet STEP 1: Fill in the blank with the name of the muscle.

1. flexion of the hip —————

2. extension of the thigh ——————

3. abduction of the thigh adduction of the thigh —————

4. extension of the arm —————

5. flexion of the arm —————

4. abduction of arm at shoulder ——————

5. rotation of the head ——————

6. flexion of abdomen —————-

7. lateral flexion of the abdomen ——————

8. lateral rotation of the abdomen

9. Elevation of the ribs

10. Elevation of the mandible

Answers

1. Contraction of the iliacus and psoas major produces flexion of the hip joint

2. quadriceps femoris muscle group

3. A combination of gluteal and thigh muscles also adduct, abduct, and rotate the thigh and lower leg. The tensor fascia latae is a thick, squarish muscle in the superior aspect of the lateral thigh. It acts as a synergist of the gluteus medius and iliopsoas in flexing and abducting the thigh.

4. triceps brachii

5. The major muscle that laterally flexes and rotates the head is the sternocleidomastoid

6. Rectus abdominis

7. The external obliques are the outermost abdominal muscles. They are also key participants in spinal flexion and the compression of the viscera. Individually, they act alongside the internal obliques in lateral flexion and spinal rotation.

8. abdominal external oblique muscle

9. external intercostal muscles

Which organisms use photosynthesis to make their own food

Answers

Plants (autotrophs). Plants use water, sunlight, and carbon dioxide to make energy (this is photosynthesis). Animals are heterotrophs, which get there food from someone or something.

Why is environmental science important environmental science addresses (1)____ strategies so we utilize our natural resources efficiently. It also provides us with knowledge on how to lead an (2)_____ lifestyle

1. Recycling, business, social
2.luxurious, healthy, eco-friendly

Answers

1. recycling

2. eco-friendly

Environmental science deals with biology along with geography and the environment. It addresses a recycling strategy and aids in leading an eco-friendly lifestyle.

What is a recycling strategy?

A recycling strategy is a technique that includes the waste material into reusable material so that the pollution is reduced and the product is used efficiently.

The sciences aid in leading an eco-friendly life as they reduce the negative impact on the environment and make the world a better place.

Therefore, recycling and eco-friendly are the correct blanks.

Learn more about recycling here:

https://brainly.com/question/11966464

#SPJ2

CAN SOMEONE PLEASEEE HELP ME WITH THIS SCIENCE QUESTION THANK YOU !!​

Answers

Answer:

The answer is D.

Explanation:

Farmers have to continuously use the pesticides once used the first time because they have become an indispensable part of an agricultural cycle.

#teamtrees #WAP (Water And Plant)

Which information can be determined using half-life?

Answers

Answer : In radioactive decay, the half-life is the length of time after which there is a 50% chance that an atom will have undergone nuclear decay. It varies depending on the atom type and isotope, and is usually determined experimentally.

hope it will help you

Answer:d

Explanation:

I did the quiz

How are seeds produced?​

Answers

Answer:

When the ovum is fertilized by pollen tube core, it starts a process of differentiation which leads to the seed generation. In angiosperms, the fruit formation occurs from the ovary of flowers, simultaneously and in a similar way to the formation of seeds.

Explanation:

PLZ mark me as brainlist plzz

A researcher places part of a plant cell in a beaker of water. She observes that the plant leaves release bubbles of gas when she shines a light on the beaker. The leaves do not release gas when the beaker is placed in the dark. Based on her observations, which of the following is the most logical inference?

Answers

Answer:

Explanation:

a

A researcher places part of a plant cell in a beaker of water. She observes that the plant leaves release bubbles of gas when she shines a light on the beaker, and this is due to the plants going through photosynthesis, which is in Option B.

What is the product and the bubble formation in photosynthesis?

The bubbles that are seen in water when plants are kept in light are actually oxygen bubbles. During photosynthesis, plants use sunlight, carbon dioxide, and water to produce glucose (sugar) and oxygen. The oxygen produced during photosynthesis is released into the surrounding environment as a waste product. When plants are submerged in water, this oxygen can accumulate and form bubbles. This process is called bubbling. The bubbles that are seen in the water are an indication that the plant is actively photosynthesizing and producing oxygen.

Hence, she observes that the plant leaves release bubbles of gas when she shines a light on the beaker, and this is due to the plants going through photosynthesis, which is in Option B.

Learn more about the product and bubble formation in photosynthesis here.

https://brainly.com/question/1262516

#SPJ2

In which situation might a gene pool contain an allele that causes a lethal
disease?
A. If the allele is in the mitochondria
B. If the allele is expressed after reproduction has occurred
C. If the allele is on the Y chromosome
D. If the allele is expressed in its dominant form

Answers

correct answer is B; if the allele is expressed after reproduction has occurred.

The situation in which a gene pool contain an allele that causes a lethal disease is: (B) If the allele is expressed after reproduction has occurred.

When the allele is expressed after reproduction has occurred, individuals carrying the lethal allele can reproduce and pass on the allele before the disease is expressed. Since the disease may not manifest until later in life or after reproduction has occurred, the allele can persist in the gene pool without being selected against. Over generations, the allele frequency can remain relatively stable, leading to the presence of the lethal allele in the gene pool.

An allele can be defined as a variant form of gene. Alleles can exist in different forms due to changes in the DNA sequence. These changes can be substitutions, deletions, insertions, or other types of genetic mutations.

To know more about allele, here

brainly.com/question/2973829

#SPJ2



Has the research described in this article been

peer reviewed?

Answers

Answer:

Meaning, example of Peer reviewed article

Explanation:

Peer review refers to procedure of scrutinizing a researcher's scholarly work, by other experts & specialists in the similar field.

This provides an important advantage of this is proper scientific, logical verification of the study.

Examples of some peer reviewed journals : Journal of child & adolescent Psychiatric Nursing

Answer:

the article does not say

Explanation:

edge 22

modeling DNA Mutations Table
base sequence of mutated strand

Answers

Answer: Only a single codon in the gene sequence is changed in base substitution mutation. Although a base substitution alters only a single codon in a gene, it can still have a significant impact on protein production.

Explanation:

Which of the following is found on RNA but not DNA?

Answers

Answer:

Uracil (U) is a nitrogenous base found only in RNA but DNA is deprived of it. In DNA Thymine is found.

Explanation:

If cells were a school building, the cell membrane would most likely be represented by which of the following?
А
intercom
B
lockers
С
teachers and students
D
walls and doors

Answers

d-walls and doors would represent the cell membrane

The digestive and excretory systems guided notes

Answers

Answer:

what notes

Explanation:

2. What fluvial landform is A?

Answers

Answer:

The landform marked with A is an ox-bow lake.

Explanation:

In the image, we can see a river and another fluvial landform right next to it. The river is meandering, moving through the plain in a zig-zag manner. The landform next to it has a half-circular shape, and it seems as it has been attached to the river until recently. In fact, the landform next to the river has been a part of the river until recently, but because of moving too far away from the base it became detached.

The landform in question is an ox-bow lake. This is a lake that has a short lifespan, and it usually has a half-circular shape, being just a few meters away from the river from which it formed. Initially, the ox-bow lake was actually part of the river and its meandering, but as the erosion was moving the water further and further away from the base of the river bed, the water was moving harder and harder, so naturally, the water moves in a direction where it is easier to do so. Little by little, the river starts to move in another direction, closer to its base, and the part of the meander that went too far away gets detached, thus forming an ox-bow lake.

If sunlight and a radio wave are both traveling through water, compare the speed of each wave. Explain how you know.

Answers

Answer:

Speed of both will be decreases when they travel through the medium of water.

Explanation:

Both sunlight and radio wave has the same speed in vacuum but both speed will be decreases when they travel through the medium of water because the consistency of water is more than air which make hard to travel for sunlight and radio wave. The speed of sunlight is slightly decreases but the radio wave can't go too far in the water and finally stops so we can say that sunlight can travel through water but radio wave none.

What do you think humans and arthropods have in common?

Answers

Muscle and nerve cells are also alike in human beings and arthropods.  Both have brains, hearts, digestive tracts, reproductive organs, and muscle groups that do more or less the same matters.

Arthropods are invertebrate animals having an exoskeleton, a segmented body, and paired jointed appendages. Arthropods form the phylum Arthropoda. they may be outstanding by means of their jointed limbs and cuticle made from chitin, frequently mineralized with calcium carbonate.

Arthropods are beneficial for different meals that humans eat, especially thru the pollination of plants. greater than 100 food plants are pollinated via arthropods on a yearly basis. Bees, one of the foremost plant pollinators, also produce honey.

Arthropods also are invaluable to human beings, as they're used in many one-of-a-kind human-made products. Examples are: Bees produce honey and their honeycombs contain beeswax, broadly used for making candles, fixtures wax and polishes, waxed papers, antiseptics, and fillings for surgical uses.

Learn more about arthropods here:-https://brainly.com/question/20415873

#SPJ1

Indicate whether a solution will have more OH– or H+ if the pH value of the solution
is 10.

Answers

A pH level of 10 is very alkaline, and one indicator of a solution being an base would be that it was a hydroxide (OH-) therefore the solution would have more OH- .

The solution with a pH value of 10 will have more OH- ions.  

In chemistry, pH is described as a scale that is specifically utilized to specify the basicity or acidity of an aqueous solution. The pH of different solutions are described as follows:

Acidic solution: If a solution has pH<7, then the solution is acidic and tend to have more H+ ions than OH- ions Neutral solution: The solution is neutral when pH=7 and the concentration of H+ and OH- ions are the same Basic solution: If a solution has pH>7, then the solution is Basic and tend to have more OH- ions than H+ ions

Thus, in this case, pH>7 and thus we can conclude that the solution will have more OH- ions than H+ ions.

Learn more about pH here:

https://brainly.com/question/1254748

Jorge hits a drum as hard as he can, and it makes a loud sound. Then he hits the same drum with less strength, and it makes a quieter sound. Which statement best explains why hitting the drum at different strengths produces sounds at different volumes? A. The vibrations are the same at each strength. B. The vibrations are different at each strength. C. The pitch is the same at each strength. D. The pitch is different at each strengh​

Answers

Answer:

D is the answer

^_^

^ Above is the right answer

Planarians are a group of ____________ , free-living flatworms that capture their food via a process of wrapping around it, entangling it in slime, and pinning it down before a ____________ extends from the mouth, bringing the prey into a gastrovascular cavity where ____________ digestion occurs.

Answers

Explanation:

Planarians are a group of Turbellaria, free-living flatworms that capture their food via a process of wrapping around it, entangling it in slime, and pinning it down before a prey into a gastrovascu lar cavity where free-living flatworms that capture extends from the mouth, bringing the prey into a gastrovascular cavity where free-living flatworms that capture extends from the mouth, bringing the digestion occurs.

Other Questions
an organism that obtains energy by feeding on other organisms when the Dixon family traded in their old car, it had 53,790 miles on it. they had the car for 8.25 years. on average, how many miles did they drive per year? PLEASE HELP!!!The emperor who forbid the clergy to have wives was:PaulCharlemagneBonifaceAugustine Find a solution to the system. Make sure to write as a coordinate. What was the proposed new educational program which focuses on human potential and achievements and studied history, literature, and philosophy?A psychologyB fascismC sociologyD humanism Which of the following is NOT a function of the skin?A. Regulates body temperature.B. Provides a physical barrier between the outside world and your body.C. Stores minerals.D. Sends messages about your environment to the brain. why do people attach filter to their faucets in at home? Which do you think is more important: Motorized vehicles like cars and airplanes or computers? During a tennis match, a player serves the ball at 23.6 m/s, with the center of the ball leaving the racquet horizontally 2.37 m above the court surface. The net is 12 m away and 0.90 m high. When the ball reaches the net, (a) does the ball clear it and (b) what is the distance between the center of the ball and the top of the net? Suppose that, instead, the ball is served as before but now it leaves the racquet at 5.00 below the horizontal. When the ball reaches the net, (c) does the ball clear it and (d) what now is the distance between the center of the ball and the top of the net? True or false, USBs are slower than RAM. How do you divide 10.5 divided by2.5? How would I unrationalize this fraction?I am trying to find the cotangent in simplest form My teacher doesnt really explain stuff good cause of her accent. May someone please explain how to do the problem and the correct answer? (no Trolls please) the problem is in the pic below Which of the following can be used to find the measure of angles plsss help me1)give 2 examples of systems that you use or see in your day-to-day life Which of the following statements is TRUE about heart rate and exercise? 85 POINTS TO WHOEVER CAN ANSWER THESE THREE QUESTIONS.1. In considering the reign of Peter the Great, what is the single most important action he did as ruler of Russia? How does this action make Russia different after his rule when compared to Russia before his rule?2. Peter the Great ushers in change for Russia, is there anything in Russia that stays the same during and after his rule?3. With 1-2 specific examples, compare and contrast the reign of Peter the Great of Russia to the reign of Louis XIV of France. Peter The Great Louis XIV Please help me complete this assignment. WILL GIVE BRAINLIST. WRITE IN FRENCH BTW what is the physical state of the fuel in a lighter?why happens if you press the lighter in order to let the fuel to flow out