Answer: The distance from the sun to the closest star would be less. I dont know why, but their is a star that is close to the sun. The average distance between them is about 23 astronomical units. 23 is of course less then the 39.4. Also the 23 is a little more than the distance between the sun and Uranus.
Explanation: ( This is new information, not old.)
The distance from the Sun to the closest star cannot be less than 39.4 AU because both stars will start attracting each other.
Astronomical Units:An astronomical unit is equal to the distance between the earth and the sun.The nearest star from our sun is Alpha Centauri which is 4.367 light-years away from our sun.If a star is just 34 astronomical units away from our sun, the sun and the closest star will start attracting each other due to the high gravitational force. This event results in the destruction of the solar system.Therefore, the distance from the Sun to the closest star cannot be less than 39.4 AU.
Learn more about the Astronomical unit:
https://brainly.com/question/11182986
____ can be used for different types of surgery.
a. Lenses
b. Lasers
c. Diffractions
d. Refractions
(Lasers)
Answer:
lenses can be used for diffrent types of surgery
Which of the following is an example of a negative tropism?
A. stems and leaves growing upward
B. leaves curling when touched
C. roots growing downward
D. leaves turning toward the light
Please help ASAP
Answer: B because leaves curling when touched is a negative tropism
Explanation:
Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it
Answer: aragonite oyster shell crab meal
Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals
what is alleles and how are they related to genes ?
Answer:
An allele is a variant form of a gene . Some genes have a variety of different forms , which are located at the same position , or genetic locus , on a chromosome . Humans are called diploid organisms because they have two alleles at each genetic locus , with one allele inherited from each parent.
Explanation:
Believe it
Use the following questions to write your conclusion to your lab report.
What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)
How could you make the lab better?
Answer:
WHat??
Explanation:
What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell
Answer:
B. Protein is composed of DNA which is produced in the cell
Explanation:
Answer:
B. Protein is composed of DNA which is produced in the cell
Explanation:
The option (B) is the relationship between a protein, the cell, and DNA.
In humans, Brown eyes (B) is dominant to blue eyes (b). A hom ozygous brown-eyed man marries a blue-eyed woman. What are the genotypic and phenotypic ratios of their children’s eye color?
Genotype: __________________________________
Phenotype: __________________________________
Answer:
The ratio is 50%
Explanation:
Genotype:
Bb
Phenotype: Brown eyes
Please correct me if I am wrong :)
Answer:
3 of the boxes have Capital b and only 1 box have lower case b
Explanation:
Scientists are studying the bacteria living in termites because they want to
genetically engineer......
Bacteria that can resist pests on crops.
Bacteria that can create ethanol from left over plant material.
Bacteria that create a vaccine.
Bacteria that create antibiotics.
Answer:
B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)
Bacteria that can resist pests on crops.
The following information should be considered:
In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.Learn more: https://brainly.com/question/5303391?referrer=searchResults
Adaptation is a change in a species over many generations. What is the cause of this change?
A.
The environment changes over time.
B.
Species pick traits they like.
C.
Over time, species become more like their ancestors.
Answer: is C
Explanation:
Answer: The correct answer is A. The environment changes over time.
Explanation: Adaptations allow species to be able to survive in changing locations, like Darwin observing changes in bird beaks based on their available food sources.
I was wondering if my answer was right ?
Explanation:
yes the 4th one is right so yes the one you have is right
present and debate current social and ethical implications of biotechnology and genetic engineering
Answer:
These concerns range from ethical issues to lack of knowledge on the effects genetic engineering may have. One major concern is that once an altered gene is placed in an organism, the process cannot be reversed. Public reaction to the use of rDNA in genetic engineering has been mixed.
I don't know if that's right
what are cork tissues? how are they formed?
Answer:
Cork is a protective tissue that separates the living cells of the plant from the outside environment. The formation of cork in the periderm is the result of the activity of a secondary meristem, the cork cambium, or phellogen.
Explanation:
A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet
Answer:
The answer is D, patient's diet.
Explanation:
As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.
Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.
How is gigantism diagnosed?If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.
Thus it is clear that medical books will have a medical history of patetint wityh gigantism.
To learn more about gigantism refer to the link :
https://brainly.com/question/7035609
Describe a DNA molecule and its shape
Answer:
DNA is a long molecule, made up of two strands twisted together to make a spiral known as a double helix.
Where will you find permafrost? tall grass prairie savanna chaparral tundra
Answer:
Where Is Permafrost Found? About a quarter of the entire northern hemisphere is permafrost, where the ground is frozen year-round. It's widespread in the Arctic regions of Siberia, Canada, Greenland, and Alaska—where nearly 85 percent of the state sits atop a layer of permafrost.
Explanation:
hope this helps
can someone pleasee answer thiiisss pleasee
Answer:
Hi how are you doing today Jasmine
True Or False urgebt
Answer:
The answer is true
Explanation:
true
Which sediment would have the slowest rate of deposition?
a round sediment
O a very large sediment
an irregularly shaped sediment
O a high-density sediment
Answer:
C. An irregularly shaped sediment
Explanation:
Deposition is the settling of sediments within respective basins of deposition.
Irregularly shaped sediments are the slowest to settle within a basin this is due to the frictional resistance of their surface.
As these particles hits the water, the liquid drag on their edges is very great and prevents swift settling.
A. A high density sediment and a large sediment will have a fast settling time.
B. Rounded sediments will impose no friction on the water and they fall through the liquid very fast.
Answer:
the answer is C. an irregulary shaped sediment
Explanation:
hope this helps!
How will water volume, incline gradient, and temperature affect the energy
of a stream?
Answer: Water Volume: The volume of water(discharge) in a stream affects the energy(velocity) of that stream. As the volume of the water in the stream increases, the velocity increases. ... Incline gradient: The incline gradient is also known as the slope of the stream.
Explanation:
Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level.
A. equalizes
B.does not change
C. decreases
D. increases
Answer:
D - Methyl Mercury Increases
Explanation:
The word Biomagnification has a simple explanation:
To magnify is to make bigger, meaning that the substance in question is becoming more abundant.
The "bio" part of this word is referring to the fact that it is a biological substance you are dealing with.
Question: "Methylmercury biomagnifies in an ecosystem, meaning its concentration __________ as it moves through each higher trophic level."
Answer: "The concentration of the methylmercury increases as it moves through each higher trophic level. Hence, the methylmercury biomagnifies in the ecosystem. So, based on the options given prior to the question above, Option D) increases would be your best bet."
What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below
The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.
What is asthenosphere?The asthenosphere is the upper mantle's mechanically sluggish and ductile region.
It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.
Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.
The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.
The "plastic" essence of the asthenosphere is caused by heat from below.
Thus, the correct option is D.
For more details regarding asthenosphere, visit:
https://brainly.com/question/7152935
#SPJ2
What makes each of the mechanical layers different?
A. Whether the layer is rock or metal
B. Whether the layer is solid, liquid, or in between
C. Whether the layer is dense or thick
Will give brainliest
Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B.
After asking her mother, she finds out that her mother's blood type is A. However, her father cannot remember his blood type.
Which of the following blood types could her father have?
I. A
II. B
III. AB
IV. O
A.
I or III only
B.
I, II, or IV only
C.
I, II, III, or IV
D.
II or III only
Answer:
C. I, II, III, or IV
Explanation:
I got it right on study island
Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B. In such case her father may have blood type A,B, AB, and O. Thus, option C is correct.
What is blood group?The three alleles that are A, B, and O are mainly responsible for controlling the major blood groups such as A, B, and AB, respectively. Due to this fact that humans are considered as diploid, each genotype could only include the maximum of two of them. Just to put it another way, just only two of these alleles could coexist in the single cell of the human at given time.
IA, IB, and I are considered as the three distinct alleles that could determine the person's blood type. I has been considered as the most common. These three alleles could be referred to as the A (for IA), B (for IB), and O for the sake of simplicity (for i). Because we receive one blood type allele from our biological mother and one from our biological father, each of us has two ABO blood type alleles.
Therefore, option C is correct.
Learn more about blood on:
https://brainly.com/question/14781793
#SPJ3
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answer:
TAA ATT GAC AAG ACA GAT CTC
1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.
2. codon
three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).
3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.
OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)
3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.
What is a nucleotide sequence?A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.
Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.
Learn more about nucleotide sequence, here:
https://brainly.com/question/30299889
#SPJ6
THe video uses an example of cheerleaders at a sporting event,
building a pyramid as a definition of isostatic adjustment
A: True
B: False
Which statement describes an interaction between the biosphere and the atmosphere that is related to
photosynthesis?
O During photosynthesis, plant roots take in water from soil.
O During photosynthesis, plants take in carbon dioxide from the air.
O Through photosynthesis, energy stored in plants is released into the air.
O Through photosynthesis, energy stored in plants is transferred to humans who eat them.
Answer:During photosynthesis, plant roots take in water from soil.
Explanation:
Answer:
During photosynthesis, plants take in carbon dioxide from the air.
Explanation:
The second answer is correct because it includes an interaction between the atmosphere and the biosphere.
I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )
Answer:
A is the correct answer.
Generation Number of purple flowers Number of white flowers 1 705 224 2 792 189 3 834 102 4 889 84 5 938 21 6 952 0 Ralph wanted to breed a pea plant that produced only purple flowers. He continued to breed purple-flower producing pea plants together over six generations. The results of Ralph's artificial selection are shown above. What did artificial selection do to the population of pea plants? A. caused a new species of pea plant to form B. increased its genetic diversity C. decreased its genetic diversity D. caused a pea plant to exhibit a new characteristic
Answer:
C
Explanation:
The correct answer would be that artificial selection decreased the genetic diversity of the pea plant.
Genetic diversity is a measure of the number of traits or characters.
Initially, the breeding produced a considerable population of both white and purple flower offspring. But as time goes on, the population of purple flower offspring increased while that of the white flower decreased till it eventually reached zero.
Thus, artificial breeding reduced the number of traits in the population of the offspring from two to one - a case of reduction in genetic diversity.
The correct option is C.
Answer:
c
Explanation:
Which of the following is true of ecological succession? A-pioneer organisms move into new communities first. B-primary productivity decreases as succession proceeds. C-secondary succession takes place within new communities with no previous soil. D-all of the above.
Answer: Pioneer organisms move into new communities first.
Explanation:
Which of the following statements best describes the state of DNA inside of a prokaryotic cell?
a
46 X-shaped chromosomes inside the cytoplasm
b
46 X-shaped chromosomes inside the nucleus
c
a single circular chromosome in the cytoplasm
d
a single circular chromosome in the nucleus
Answer:
C.
Explanation:
It's a single strand of circular DNA found in the central area of the cell, which is not surrounded by a nuclear membrane.