why does the temp of the air increase with the height of the stratosphere?

Answers

Answer 1

Answer:

The hot air rises and the cool air falls

Explanation:


Related Questions

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??

Answers

Answer:

Independent variable: type of instrument

Dependent variable: Number of rabbits attracted

Experimental group: The group when he played an instrument

Control group: The group when not playing an instrument

Constant: Same song

Explanation:

1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.

2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.

3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.

4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.

5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

What is the term for traits an organism possesses that help it survive better?

a.
Permutations


b.
Mutations


c.
Generations


d.
Adaptations

Answers

Answer:

d. adaptations

Explanation:

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

at which temperature would air hold the least water vapor?

Answers

Answer: I believe it's 60 degrees Fahrenheit or less, Since heat is required to have proper evaporation, then this will only be leading to a portion of the water condensed leading to a half condensation

Explanation:

Answer:

the coldest temp in F holds the least amount of water vapor..

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

The image below shows plant cells.
What feature of cells is best demonstrated in the image?
OA Cells are the basic units of structure and make up tissues.
OB. All organisms are made up of a large number of cells.
OC. All organisms have cells with different shapes and functions.
OD. Cells are formed from other cells within the same tissue.
2021 Edmentum. All rights reserved.

Answers

C.All organisms have cells with different shapes and functions

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

The workers who paid a rate for every day they work are known as

Answers

Answer:

piece work

Explanation:

I hope this is right

In what ways is the composition of the sun different from the Earth? Choose all that apply.
The Sun does not have continents.
O The Sun has a thick, solid core.
O The Sun does not have a solid surface
The Sun does not have a solid core.
The Sun has continents known as plasma zones.

Answers

Answer:

1,3,4

that's my answerrrr

all you need is in the photo ​

Answers

Pretty sure it’s third choice :))
I think it would be the third option

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

Can someone please helpppppo I’ll mark the brainliest

Answers

Answer:

C [the third one btw]

Explanation:

He believed that evolution gradually [slowly] happened over time.

Hope this helps :D Have a great day

True of False: Marsh was able to prove that animals changed over time.

Answers

Answer:

True

Explanation:

Hope this helps :D Have a great day..can i hav brainliest?

I think the answer is true


:):):):):):):):)

HELP PLEASE

At Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event?

A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites.
B. It provided money to businesses responsible for toxic waste sites to clean up their pollution
C. It helped boost the economy among those waste sites
D. It helped identify toxic waste site and move people away from them​

Answers

Answer:I’m stuck on the same question

Explanation:

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

The freezing point of a mixture of water and salt is
A. higher than that of pure water
B. the same as that of pure water
C. lower than that of pure water
D. none of the above

Answers

Answer:

lower

Explanation:

salt makes thing freeze faster

Answer:

A

Explanation:

Because when you mix a mixture and pure substances it’s higher

Which is located at the beginning of a gene?

terminator
promoter
mRNA
intron

Answers

Promoter................

What is the phase change from gas to liquid?
A. Sublimation
B. Condensation
C. Vaporization
D. Transpiration

Answers

Answer:

Condensation

Explanation:

Condensation is the phase change from gas to liquid. For example, water vapor condenses when you are taking a shower because wet spots show up on a mirror after taking a shower.

Answer:

Condensation

Explanation:

Sublimation is when a solid turns into a gas. Condensation is when water in the air collects to form droplets that gather on a surface/object. Vaporization is when a liquid forms into a gas. Transpiration is a thing in plants where water transfers throughout the plant.

Which best describes the importance of meiosis to living organisms? *
O genetic variation and growth
O growth and development
O development and sexual reproduction
O sexual reproduction and genetic variation

Answers

Answer:
Sexual Reproduction and genetic variation

Explanation:

Meiosis is important for three main reasons: it allows sexual reproduction of diploid organisms, it enables genetic diversity, and it aids the repair of genetic defects.

What are three differences between rocks and soil

Answers

Answer:

Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.

4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres

Answers

Answer:

(4) 5000°C and 3.0 million atmospheres

Explanation:

The inferred temperature is 5000°C and pressure of Earth's  interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.

NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?

2.How do you think that the one species of finch evolved into many different species, each with its own advantages?

3. In what ways do these advantages help the finches to survive and reproduce?

4. What might have happened if the finches didn't evolve into many different species?

Answers

Answer:

1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.

2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection

3.  Medium ground finches with larger beaks could take advantage of alternate food

4. three species of Darwin's tree finches have been known to inhabit Floreana  but no birds singing that song on Floreana have been heard in many years.

Explanation:

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False

Answers

False — life cycles have to do with birth to death progressions, not genetic traits.

Two offspring from same parents can have different phenotypes. How is this possible?​

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

Other Questions
an atom that has gained or lost one or more electrons divide the stars into 3 equal groups .How many stars are in each group ? what is 1/3 of 9 ? 14. After finishing her homework, Sue climbs up a 5.00 m high flight of stairs to her bedroomFind the magnitude of Sue's weightand how muchwork Sue does in climbing the stairs if shehas a mass of 50.0 kg? (4.90 x 2 N, 2450J) Question 9 of 10Which process is a form of mechanical weathering? Jacob decided to start saving for college. After 3 months, he had saved $174. His friend Victoria was inspired to do the same. After 6 months, she had saved $360. If they are both saving money at a constant rate, how many more dollars per month does Victoria save than Jacob? What is the message of this poster? A student is drinking a cup of hot chocolate as they sit by a campfire on a chilly evening. They know that the cup of hot chocolate transfers thermal energy to the surrounding air. The heated air over their cup of hot chocolate expands and rises and is replaced by cooler, denser air.This method of energy transfer is Which three lengths could be of the sides of a triangle? Darkness descended upon us, is this an active or passive voice? Is (-1,2) a solution to the following linear equation:2x + y = 2 HELP PLZ !!!! The audience sat quietly as the maestro, stretching his arms, began to conduct the orchestra.What is the participial phrase in the sentence?A. as the maestroB. to conduct the orchestraC. The audience sat quietlyD. stretching his arms I need help if you can that would be great thank you The cost, in dollars, for a group to attend a play is represented by 72p+ 250, where p is the number ofpeople attending. What is the cost for 36 people?$286$358$2,342$2,842 Why does forming bonds release energy? * The illegal copying of program What if the national government needs to pay soldiers to defend the country, but has no money? Why are the Rocky Mountains larger than the Appalachian Mountains? Imagine that an exchange student from China visits your class. While your teacher discusses how the United States has a limited government,the Chinese student raises his hand and asks why the government has limited power. Which point best highlights why the US government haslimited power?A.A limited government means citizens pay fewer taxes.B.A limited government helps people avoid breaking the law.C.A limited government protects individual freedoms.D.A limited government prevents businesses from being too powerful. ?Solve for X9x + 8 = -1 Who is the restaurant staff member shown in the image?El gerenteEl lavaplatosEl camarero El chef