Which statement correctly shows the flow of energy in a food chain?

A.
Producer→ heterotroph → decomposer

B.
Producer ← consumer ← decomposer

C.
Autotroph← decomposer ← consumer

D.
Autotroph→ decomposer→ heterotroph

Answers

Answer 1

Answer:

Producer→ heterotroph → decomposer

Explanation:


Related Questions

The natural extinction of a predator can negatively affect the
Environment by leading to
-unrestricted prey species growth.
- major climate change.
-harmful human pollution.
-increased sediment deposits.

Answers

-unrestricted prey species growth


Explanation: the less predators the more the prey will reproduce, hence the fact that no one is there to consume them they will increase at a very accelerated speed

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3

Which ingredient is a food acid used to activate baking
soda in quick breads?
o honey
o buttermilk

Answers

Answer:

Honey

Explanation:

Technically it could be both, as they can both be acidic, but honey is lower on the pH scale, meaning it is more acidic and thus will have a larger chemical reaction with baking soda.

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

Is a bird calls warning for prey a physical or behavioral adaptation?
Is an animals body temperature changing a physical or behavioral adaptation?
Is birds flying to high ground when they sense movement a physical or behavioral adaptation?

NO LINKS! NO PDF'S. Please, help ASAP!

Answers

1. the birds call is a behavioral adaptation 2. the animals body temp changing is physical. 3. the birds flying is a behavioral adaptation.

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

Which part always comes FIRST in the scientific name?

Answers

Answer:

The first part of the scientific name is the genus, and it is always capitalized. (The plural is "genera"). The second part is the species epithet. The entire name is written in italics.

Explanation:

hope this helps


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

HELPPp!!!!!!I’ll mark u brainly

Answers

Answer:

Genotypes - Phenotypes:

TT - Thin

Tt - Thin

tt - Wide upside down

LL - Lopsided

Ll - Lopsided

ll - Parallel

VV - Vertical

Vv - Veritcal

vv - Horizontal

PP - Pink

Pp - Pink

pp - Red

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Which organisms break down decaying organisms and produce an inorganic nutrient pool in ecosystems?
Group of answer choices

secondary consumer

decomposers

primary consumer

producers

Answers

Answer:

Decomposers

Explanation:

Decomposers eat decaying or dead organisms to produce the nutrients.

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1

Need help ASAP! Will give brainliest;) NO links please, will report.

Which statement is part of Darwin’s theory of evolution by natural selection?

A). Acquired characteristics that are inherited are the cause of evolution.

B). The organisms that are the fittest are always largest and strongest.

C). The number of offspring is not related to fitness.

D). More offspring are produced than can possibly survive.

Answers

D

More offspring are produced than can possibly survive.

When the ocean absorbs CO2 it leads to what?

Answers

Explanation:

Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.

Answer:

If the ocean absorbs a lot of CO2 it is most likely to become acidic

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

Other Questions
PLZ ANSWERRRR :(( Ill put 25 points!! And plz actually answerCompose complete sentences based on the following situations.12. How do you ask your friend to call you back?13. Your boss is not available. How do you ask the person on the phone to wait a few moments.Complete the following mini-dialogues by providing the appropriate greetings.14. Je te prsente mon fils, Stphane. Il a 14 ans.15. You want to introduce your wife (or husband) to your boss (M.Lebrun).16. Mme Foveau, he vous prsente Mme. Simon.17. M. Dupont, vous entendez le tlphone? (Oui)Translate the following sentences using savoir or connatre.18. Do you know my brother?19. Do you know where they live?20. Do you know when the plane arrives? please fill this up for me and the topic is: dangers of smoking A sewing class has 185 yards of fabric to make quilts. Each quilt requires 8 yards of fabric. How much fabric will remain after all the quilts are made? A coach purchases 47 hats for his players and their families at a total cost of $302. The cost of a small hat is $5.50. A medium hat costs $6.00. A large hat costs $7.00. He purchases three times as many medium hats as small hats. Using matrices, how many large hats did the coach purchase? What happened to Malcolm X after he left the Nation of Islam?A. He changed the Nation of Islam into a peaceful group.B. He moved to Saudi Arabia for spiritual reasons.C. He adopted a harder line against integration.B. He was labelled as a traitor and assassinated. HELLLLLPP FASSTT PLZZZZ!!!!!! U ANSWER THIS THANNNKKK YOU If yu were to randomly survey 500 people each from two largest us cities would this be a random study why or why not HELP NEEDED ASAP ! HELP ME WITH THIS PLEASE. THANK YOU A pretzel company calculated that there is a mean of 73.5 broken pretzels in each production run with a standard deviation of 5.1. If the distribution is approximately normal, find the probability that there will be fewer than 69 broken pretzels in a run. thirty years later the washington monument was finally completed, and the angle of elevation to the top of the monument from the same marker was 70o. to the nearest foot, how many feet were added to the phase 1 structure of the washington monument? Cual era la religin que profesaban en el imperio de Mal? Por favor es urgente. No tiren fruta porque los denuncio, gracias :) who is responsible for keeping the president up to date about what is happening in the world A car travels at the rate of 60 miles per hour and averages 30 miles per gallon of gasoline. Which of the following is the bestapproximation of the number of gallons of gasoline that will be used in 8 hours of traveling at 60 miles per hour?0.06 gallons16 gallons3.75 gallons7.5 gallons480 gallons What is the surface area of this square pyramid 18 ft33ft36 ft57 ft Hardy Company must maintain a compensating balance of $50,000 in its checking account as one of the conditions of its short-term 6% bank loan of $500,000. Hardy's checking account earns 2% interest. Ordinarily, Hardy would maintain a $20,000 balance in the account for transaction purposes. What is the loan's approximate effective interest rate 10 medications for diabetes help me please!!! asap! A town has a population of 2000 and grows at 4% every year. What will be thepopulation after 15 years, to the nearest whole number? 20 POINT!!Can someone help me I dont understand it at all How did the Louisiana purchase become official