Which organism cannot perform asexual reproduction?

humans
fungi
earthworms
potatoes

Answers

Answer 1

Answer: Humans

Explanation:

They perform sexual reproduction.

Answer 2
Humans because they perform sexual reproduction

Related Questions

how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet​

Answers

Answer:

Due to no jaws, no paired fins and scales on the body.

Explanation:

Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of  scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.

In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?

Answers

Answer: B

Explanation:

''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.

Experiment performed by Francesco Redi

Francesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.

Learn more about cell theory here: https://brainly.com/question/3966602

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

although farmers once used only organic fertilizers to replenish nutrients in the soils, some have been replaced with synthetic fertilizers. Although synthetic fertilizers keep nutrient levels high and increase crop yields, they can have an effect on the environment. Which of the following would most likely lead to a ban of synthetic fertilizers?


A. Synthetic fertilizers help prevent the spread of diseases.


B. Synthetic fertilizers are less expensive than organic fertilizers.


C. Synthetic fertilizers increase the potential for environmental pollution.


D. Synthetic fertilizers provide nutrients, like nitrogen that can disrupt nutrient cycling.

Answers

Answer: C. Synthetic fertilizers increase the potential for environmental pollution.

Explanation:

A fertilizer is a material which when applied to soil ,supply one or more plant nutrients essential to the growth of plants.

Fertilizers could be organic ( obtained from nature ) or could be synthetic ( made artificially in labs).

Though synthetic fertilizers such as urea keep nutrient levels high and increase crop yields but they also kill beneficial microorganisms in the soil that convert dead human and plant remains into nutrient-rich organic matter. The non biodegardable synthetic fertilizers seep into groundwater and increase its toxicity, causing water pollution.

Synthetic fertilizers damage the natural makeup of the soil. Plants that grow in soils which use synthetic fertilizers are deficient in iron, zinc, carotene, vitamin C, copper and protein.

Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia

Answers

B is the correct answer

Answer:

its malaria

Explanation:

I got it wrong and it showed me that it was malaria

Michael loves playing his clarinet and believes it attracts more rabbits than any other instrument he
has played. In order to test his hypothesis, Michael played a song on his clarinet for a total of 5
minutes and counted the number of rabbits he saw in his front yard. He played the song a total of 3
times on his clarinet and repeated the experiment using a flute and a guitar. He also recorded the
number of rabbits he observed when he was not playing an instrument. The results are shown in the
chart.
Number of Rabbits
TRIAL
NO MUSIC
CLARINET
FLUTE
GUITAR
15
1
2
3
5
3
2
10
12
5
8
9
12
18
7
1) What is the independent variable?
2) What is the dependent variable?
3) What is the experimental group?
4) What is the control group?
5) What is one constant from the experiment above??

Answers

Answer:

Independent variable: type of instrument

Dependent variable: Number of rabbits attracted

Experimental group: The group when he played an instrument

Control group: The group when not playing an instrument

Constant: Same song

Explanation:

1. Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the variable that is changed is the TYPE OF INSTRUMENT used (clarinet, flute, guitar), hence, it is the independent variable.

2. Dependent variable is the variable that is measured in an experiment. It is the variable that responds to the changes made to the independent variable. In this experiment, the dependent variable is the "NUMBER OF RABBITS ATTRACTED" by the instrument played.

3. Experimental group is the group of an experiment that receives experiment treatment, which is the independent variable. In this case, the experimental group is the GROUP IN WHICH INSTRUMENT WAS PLAYED.

4. Control group is the group that does not receive the experimental treatment. In this case, the control group is the group in which INSTRUMENT WAS NOT PLAYED.

5. Constants are those variables that remains unchanged for all groups throughout the experiment. In this case, one constant is the SAME SONG played.

Any one free
InboX me (◍•ᴗ•◍)❤​

Answers

Answer:

hiii

Explanation:

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

Which is an advantage of genetic engineering?
A lack of labeling of food products that have been genetically engineered
B diminished opportunities for organic agriculture
C lack of long-term studies on food safety and environmental impact
D diminished effects of diseases on crops

Answers

Answer:

The answer is D.) Diminished effects of diseases on crops.

Explanation: I just took the quiz on edge 2021 :)

An advantage of genetic engineering is the diminished effects of diseases on crops. The correct option is D.

What is genetic engineering?

Genetic engineering, often known as genetic modification or genetic manipulation, is the use of biotechnology to directly manipulate an organism's DNA.

The manipulation or modification of an organism's DNA or cells is known as genetic engineering. Cloning is an excellent illustration of genetic engineering in action.

The main worries concerning the negative consequences of GM foods on health include the transmission of antibiotic resistance, toxicity, and allergenic. From the standpoint of allergies, there are two difficulties.

Therefore, the correct option is D, diminished effects of diseases on crops.

To learn more about genetic engineering, refer to the link:

https://brainly.com/question/13491558

#SPJ5

Do all plants respond the same to all abiotic factors?

Answers

Answer:

Light intensity: limited light will limit photosynthesis. This will affect the distribution of plants, and therefore the distribution of animals that eat plants. ... Temperature: temperature is a limiting factor for photosynthesis - and low temperature therefore limits growth of plants.

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

Which of the following below, best describes a cell from bacteria?
A. A multicellular organism

B. A cell with many organelles

C. Multicellular, Eukaryote

D. Unicellular, prokaryote

Answers

A multicellular organism

what do eukaryotic cells and viruses have in common?​

Answers

Answer:

Just search it up

Explanation:

Hello There!

What do viruses have in common with eukaryotic cells?

-Viruses are not cells, but they do have certain things in common.

Viruses & Eukaryotic cells :-

1.Contain DNA, but not much.

2.Can not reproduce by themselves.

3.Have important features such as nucleic acid gnomes.

4.Have genetic variations and can certainly evolve.

Hope This Helps!

Thank you!!! Good Day! ♡

What portions of RNA are cut out and discarded during the process of RNA editing

Answers

Answer:

 introns are portions of RNA that are cut out and discarded.

Explanation:

When a strong acid is added to a strong base a_________________ reaction occurs in the product will have a PH closer to_____

A. Neutralization,7
B. Ionic,0
C. Concentration,14

Answers

Answer:

A

Explanation:

Acids and bases when mixed neutralize eachother. and 7 is neutral on the PH scale

Plz help me its only 1 question

Answers

Answer:

the first one

Explanation:

the car slowly started and accelerated

Its the second one. Since its continually accelerating.

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Which cell type has organelles that are NOT membrane-bound, eukaryotic or prokaryotic? PLEASE HELP

Answers

The answer is prokaryotic

Which antivenom will save Tyler?

Select one:

a.
Antivenom A


b.
Antivenom B


c.
Antivenom C


d.
Antivenom D

Answers

Answer:

b

Explanation:

what is the difference between climate and wheather

Answers

Answer:

Weather reflects short-term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.

:P

Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?

Answers

A water lily will have more stomata. A desert cactus will have very few stomata, because in deserts plants face water shortage so in order to avoid loss of water cacti have adapted to the desert environment by possessing few stomata.

The stomata of a desert cactus will close during the day.

STOMATA:

The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases.

The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss.

Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day.

Therefore, the stomata of a desert cactus will close during the day.

Learn more at: https://brainly.com/question/3387375?referrer=searchResults

Insecticides can pollute the topsoil.
True or false ?

Answers

Answer:

True

Explanation:

Some insecticides when applied may persist for longer periods and that is very harmful because the soil is degraded and living organisms in the soil may be harmed leading to soil erosion. Then the soil will lose its fertility.

Which of the following provides the best summary of the process of natural
selection?
A. Populations become better adapted to their environment.
B. Individuals pass on their best traits to their offspring.
C. Individuals always change in response to their environment.
D. Population sizes increase with every generation.
SUBMI

Answers

Answer:

c

Explanation:

Arrange the levels of ecological organizations from smallest to largest

population
organism
community
ecosystem

Answers

Organism, Community, population, ecosystem

Combined sewage overflow has been linked to eutrophication in ecosystems within NYC, including Jamaica Bay and Coney Island Creek. Based on your understanding of eutrophication, why might combined sewage overflow be causing an overgrowth of harmful algae in NYC? Explain your answer in YOUR OWN WORDS please.

(This is 7th grade science).

Answers

like your name

Explanation:

You want to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%). How much of each will he have to mix together? Show your work for full credit.

Answers

Answer:

To make a 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%), 0.6 tons of soybean meal and 0.4 tons of corn are needed

Explanation:

Using the Pearson’s Square calculations:

1. Subtract across the diagonal:

a. 18% - 12% = 6 parts soybean meal

b. 18% - 22% = 4 parts corn

2. Sum the parts:

a. 6 parts soybean meal + 4 parts corn = 10 totalparts

3. Divide each part by the total to calculate the percentage of each feed to include in the ration:

a. 6 parts soybean meal ÷ 10 total parts * 100 = 60.0% soybean meal

b. 4 parts corn ÷ 10 total parts * 100 = 40.0% corn

So, to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%),

60% of soybean meal is needed = 60/100 * 1 ton = 0.6 tons of soybean meal

40% of corn is needed = 40/100 * 1 ton = 0.4 tons of corn

Fill in the blank: ______ is the process that splits rock when water seeps into cracks, then freezes and expands.
YES I WILL HAVE A LOT OF FILL IN THE BLANK GET READY

Answers

Answer:

Freeze-thaw

Explanation:

Answer:

frost wedging

Explanation:

Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.

Answers

Caves

Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.

one is missing but u can just check it on quizlet

23. Which of the below names is not a type of biologist?
a) paleontologist
b) botanist
I
c) zoologist
d) astrophysicist
BA

Answers

Answer:

D

explanation: it literally has physics in its name

Other Questions
what is the area of a circle whose radius is 4x centimeters? write your answer in terms of pi. Lyndon Johnson played an important role in the passage of the Anna planted 90 bulbs in 60 minutes minutes. At this rate, how many bulbs can Anna plant in 2.5 hours?90150225250 Desiree writes songs for her band. her first song is 3 1/2 minutes long. Her second song is 1 1/2 times as long as her first song. her third song is 2/3 times as long as her second song. How many minutes long are the second and third songs? Select from the drop-down menu the pronoun that best completes the sentence. Henry met _____ on a hiking trip. A.he B.herC.she D.their Why should masks be mandatory?Pls answeerrre A jar contains 25 coins of only dimes and quarters. The value of the jar is $4.45. Write the equation that represent the money value in the jar. Let d = dimes and q = quarters. Do not put any spaces in your answer. My cousin works very hard. He is a machine that never stops." This is a ...A. simile exampleB. metaphor exampleC. personification example The Girl in the Picture I loved to look at the old photographs, especially the ones with me in them. I suppose that was bad of me and proved I was stuck on myself, but I couldn't help it. The pictures with me in them were just more interesting. Every stage of my life was there, snapped by the camera and stamped on a glossy piece of paper. I loved seeing myself at three, standing with my brother, Donald, in front of the house in our matching cowboy and cowgirl outfits, or standing on a chair in front of the kitchen counter, mixing a birthday cake for Mother. The pictures reminded me that I was real, that I always had been real and always would be real, and that I wasn't just some girl someone had made up.2The narrator's family is portrayed as being A. a wealthy family. B. a very unhappy family. C. a close, loving family. D. a family that often fought. In what ways did South Carolina participate in the events leading up to the American revolution pls help me and hve a nice day ;p What is the problem of a number and negative 8 How does the information in the fourth sentence of the first paragraph ("Denis ... hands") connect Denis with Maltroit?ADenis appreciates Maltroit's status.BNeither man has authentic aristocratic heritage.Denis welcomes Maltroit's handshake,DBoth men demonstrate reserve and a cold arrogance.EMaltroit and Denis are family relations, r/15-3 solve the inequality How do you turn 8x-4y=20 into slope intercept form?Please show me the steps 5. How many adverbs are there in this excerpt from the passage?"We are very miserable," said Darzee. "One of our babies fell out of the nestyesterday and Nag ate him." Estimate the net force needed to accelerate a 1000-kg car at 3m/s/s from rest. FILL IN THE BLANKS.If this force acts on this car for 4 seconds, then the car will increase its speed by - m/s a second each second reaching a final speed of - m/s. The distance traveled during this motion is - meters. 1.What element is located at period 3, group 13?2.Element at group 4, period 5? PLEASE HELPWhat is the effect of the exposition on "President Cleveland, Where Are You?"?It explains how Rollie Tremaine helps Jerry do something kind for Armand.It is the point when Jerry begins to consider other people's needs before his own.It provides detailed background information about the people in Jerry's family. It describes Jerry's intense interest in collecting cowboy cards. what is responsible for cultural divergence in europe?