Which of these is a main political factor that helped bring an end to the American Revolution? Alliance with France Alliance with Germany Loans from Britain Loans from Italy

Answers

Answer 1

Answer:

The answer to this question is the alliance with France.

Explanation:

During the American Revolution, the war had been in Britain's favor until the Battle of Saratoga. This battle proved to be a successful American victory which convinced France to ally with Americans. The French had provided supplies, arms, ammunitions, and military support to the American army. This alliance was a main political factor had helped turn the war in favor of America, leading to the eventual independence from Britain.


Related Questions

okay last question! How did Muslims advance in medicine?

50 points + brainiest!

If you don't know, don't worry. <3

Answers

Answer:

Islamic doctors developed new techniques in medicine, dissection, surgery, and pharmacology. They founded the first hospitals, introduced physician training, and wrote encyclopedias of medical knowledge.

Explanation:

State TWO problems children in a single-parent family may face.

Answers

State TWO problems children in a single-parent family may face.

Problems with school

For most kids if they weren't always in a single parent family it could take them a while to adjust to their new lifestyle and this may potentially affect them emotionally and can cause a lack in their performance at school.

Relationship difficulties

I mean this in the way that they may struggle with forming new relationships in a school environment as they may be scared how others will treat them knowing that and they may have expectations of certain relationships because of pervious experiences.  

Answer:

Visitation and custody problems.

Less opportunity for parents and children to spend time together.

Explanation:

Many single parents rely on their own incomes to keep them and their families afloat, so if a parent is constantly at work, their child/ren will not be able to see them as much.

With which subjects does population have a close relation?​

Answers

Answer:

Geography

Explanation:

Geography deals with study of man and his physical environment. In every environment ,population is so essential to its growth and development.

Your ASSIGNMENT Early South American civilizations shared some important cultural practices. They practiced their religions in a similar way, and they used some of the same artistic methods. Early South American civilizations also had a lot in common with the civilizations that first developed in other parts of the world. Select two regions from the map and compare the early civilizations in those regions to early civilizations in South America. Then explain why you think civilizations that never had contact with one another had so much in common. Your answer should be two paragraphs long..​

Answers

Answer:

yoooo sup shawty

In early civilization, Mesopotamia and Mesoamerica are diverse from early South America because people in the Americas developed an entirely different menu of foods than those in Mesopotamia and Mesoamerica. The areas in which civilization developed in Mesoamerica include Mexico and Mesopotamia include Sumerians. Also, people in South America were hunter-gathers people. Mesopotamia and Mesoamerica people weren't.

In South America, early civilizations developed along the coast. All three regions had rainy areas, dry places along the coast. Because of the different types of land and weather, a variety of plants and animals lived there. All three regions also developed a system of trade.

Explanation:

How is Cuba’s economy affected by the government?

Answers

Answer:

They have a Communist, Command economy.

Explanation:

The supply and price are regulated by the government, rather than market forces like in the U.S

When people are having trouble communicating, it can be helpful to find a good time to discuss the way they communicate. This is also called...
Group of answer choices

semantics

circular causality

positive feedback

metacommunication

Answers

Answer:

metacommunication

Explanation:

What led to the Boston Massacre in 1770? Debt from French and Indian War High taxes for property owners Presence of British soldiers in Boston Reduced prices on imported goods

Answers

Answer: Tensions started to rise, and a patriot crowd assaulted a British loyalist in Boston in February 1770, killing a youngster when he shot a rifle at them. Brawls between colonists and British soldiers continued over the next few days, culminating in the Boston Massacre.

Explanation:

The British Parliament adopted rigorous measures for the collection of revenue taxes in the colonies in 1767, in an attempt to recuperate the great money lost in the defense of its North American colonies during the French and Indian War (1754–63). Those responsibilities were part of a set of four legislation known as the Townshend Acts, which were meant to impose Parliament's power over the colonies, in contrast to the British government's policy of salutary neglect in the early to mid-eighteenth century. Many colonists in Massachusetts were outraged when such tariffs were imposed on lead, glass, paper, paint, and tea when they arrived in colonial ports. The colonial response included harassment of British officials and vandalism, in addition to planned boycotts of particular items.

In the context of the sociological perspectives on religion, __________ emphasizes the ways in which religious beliefs and rituals can bind people together in a society.

Answers

Answer:

functionalism

Explanation:

Sorry the answer is late. I'd tell you where I got the answer from, but Brainly won't let me. It's correct though!

In what way do the views and opinions of ordinary citizens affect presidential power?

Answers

Answer:

{Answer deleted}

Explanation: {answer deleted}

The Vedas is:

A. writings from the Mauryan Empire
B. the polytheistic religion of India
C. wisdom literature and philosophy in Sanskrit
D. religious prayers and ritual of China

Answers

The answer is C! A Sanskrit text

Answer:

C

Explanation:

are a large body of religious texts originating in ancient India. Composed in Vedic Sanskrit, the texts constitute the oldest layer of Sanskrit literature and the oldest scriptures of Hinduism.

Piaget's stages of cognitive development represent universal aspects of human development.

True or false

Answers

Answer:

false

Explanation:

it is not aspects of human development

The phases of cognitive development identified by Piaget serve as benchmarks for all stages of human growth. This is untrue

What is the development?

Without diminishing the natural resources of the environment, development is a process that promotes growth, advancement, and positive change in the economic, environmental, social, and demographic aspects. All projects must have clearance, but they are broken down into three categories since each one has various levels of influence. Complying,

The national budget is allocated for carrying out a number of government initiatives and programs, maintaining government buildings, paying the wages of government personnel, and paying off public debts. Three categories—expense class, sector, and implementing government unit—are used to categorize these expenditures.

Four stages of growth. According to Jean Piaget's theory of cognitive development, humans pass through the sensorimotor stage, preoperational stage, concrete operational stage, and formal operational stage as they develop.

Therefore, The development identified by Piaget serves as a benchmark for all stages of human growth.

Learn more about development here:

https://brainly.com/question/28011228

#SPJ2

Why should you avoid sun exposure between the hours of 10 AM - 2 PM? *
1 point
You should be working on your Science lessons.
The IV rays are the most intense during those times.
The UV rays are the most intense during those times.

Answers

The sun's rays are strongest between 10 a.m. and 4 p.m. Limit exposure to the sun during these hours, even in winter and especially at higher altitudes. Do not burn. Sunburns significantly increase the lifetime risk of developing skin cancer, especially for children.

Answer:The UV rays are the most intense during those times.

so C

Explanation:

definir racismo, sin palabras raras

Answers

Answer:

El racismo es la creencia de que grupos de humanos poseen diferentes rasgos de comportamiento correspondientes a atributos heredados y pueden dividirse en función de la superioridad de una raza sobre otra.

who is the president of eritrea 2021​

Answers

Explanation:

[tex] \bold \blue{ Isaias \: Afwerki}[/tex]

Research on subliminal perception suggests that: a. subliminal perception is impossible. b. unconscious information does not influence people's motivations. c. subliminal perception can lead to important changes in personality. d. subliminal perception can usually influence people's motivations.

Answers

D

Hopes this helps to answer your question

“If this wild project succeeds, under the auspices of Thomas Jefferson, President of the United States, and three hundred thousand slaves are set free in Virginia, farewell to the safety, prosperity, the importance, perhaps the very existence of the Southern States.”

—Anonymous Southern Planter, 1796

Which post-Revolutionary War trend does the passage best illustrate?

A.
changes in state constitutions outlawing slavery

B.
strong resistance to abolition

C.
the rise of manumissions

D.
African American contribution to the war effort

Answers

Answer:

A

changes in state constitution outlawing slavery

Answer:

Which post-Revolutionary War trend does the passage best illustrate?

B. "strong resistance to abolition" is correct in Connexus.

Explanation:

I selected A. changes in state constitutions outlawing slavery and it was wrong for the Semester A Exam Review in US history.

what is the relation between population and economic?​

Answers

Answer:

Economy is basically a society, and population is how many people live or work inside the community. Economy is basically doing labor work and then using it to buy food, clothing, shelter, education, health facility, etc. Which will be achieved if there was a good economy. Population is basically the amount of total people either living or visiting the community, town, city, state, country. Example: Philadelphia, PA is populated by  1,600,000+ people/citizens.

PLEASE HELP NOW If YOU KNOW YOUR RIGHT
What are the FOUR geographical regions of Honduras?
interior highlands
Mosquito Coast
rain forest
Coastal plains
Pacific lowlands
semiarid deserts
Caribbean lowlands

Answers

Answer:

the central highlands, Pacific lowlands, eastern Caribbean lowlands, and northern coastal plains and mountains.

Explanation:

Rachel's mother takes her to the pediatrician for her 1-year checkup. Rachel is very friendly towards everyone she meets in the waiting room; she didn't show any reaction when her mother left her in the room nor upon her mother's return. According to Ainsworth, these are indicators that Rachel is:

Answers

Children are known to grow a form of attachment to parents. According to Ainsworth, these are indicators that Rachel is Avoidantly attached.

Avoidant attachment is known to be a kind of an attachment style that is formed during early childhood. It takes place in children who do not have any first hand experience on sensitive responses to their needs or distress.

Children with this kind of attachment style can be said to be very independent, both physically and emotionally. Ainsworth gave three major styles of attachment. They are;

Secure attachment Ambivalent-insecure attachmentAvoidant-insecure attachment.

Learn more about Avoidantly attached from

https://brainly.com/question/14027975

bio graphy of amar singh thapa dealth reason​

Answers

Explanation:

As Anglo-Nepal War went against Nepal, Nepal had to Sign the Sugauli Treaty with English people. Grieved with this incident, Ambar Singh Thapa went to Gosainkunda for ascetism, voluntarily retired and died on a pilgrimage to Gosaikunda.

Have a great day.

I cause acid rain ______.
A) water pollution B) air pollution
C) land pollution. D) noise pollution​

Answers

Answer:

B

Explanation:

Answer: B) air pollution

Brainliest pls if correct!

All of these are describing events in which country?

Answers

Could be any country tbh

Since the question is not complete, we can only explain what a country is. A country is  known to be any nation or  people of a specific geographical and such as the United States.

Can you say the United States is a country?

Yes, the  United States which is officially called the United States of America is a country. It is often abbreviated as U.S. or U.S.A. It is a country that is found in North America and it is made up of 50 states.

Conclusively, some major events and festivals in the United States are:

Sundance Film Festival.Super Bowl Sunday.Masters Golf Tournament, etc.

Learn more about country from

https://brainly.com/question/324911

What element that is the primary cause In. Pollution of Great Lakes

Answers

Answer:

Heavy industry, manufacturing and agriculture are three of the major causes of pollution of the Great Lakes system. The production of persistent organic pollutants (POPs) such as PCBs, DDT and dioxins, had previously been of principal concern.

Explanation:

Hope this helps!

What element that is the primary cause In Pollution of Great Lakes.

Answer: Heavy industry, manufacturing and agriculture are three of the major causes of pollution of the Great Lakes system. The production of persistent organic pollutants (POPs) such as PCBs, DDT and dioxins, had previously been of principal concern

What if all guns disappeared? Would the world be better or worse off?

Answers

Answer:

probly worse bc they would come up with worse ways to kill somebody but at the same time the animal population will increase

Explanation:

Answer:

Worse. People wouldn't be able to hunt as easily, and society would quickly fall to starvation and chaos.

Explanation:

Make a list of the functions of legislative and explain any three of them briefy​

Answers

Answer:

passing laws, establishing the government's budget, confirming executive appointments, ratifying treaties

Explanation:

paki follow lng po sa akin

Which characteristics did early Japanese, Chinese, and Korean civilizations share?

They were friendly nations that shared culture and customs.
They were nations at war that shared a common religion.
They were neighboring countries that shared a common history.
They were countries with dissimilar culture and customs.

Answers

Based on historical perspective, the characteristics early Japanese, Chinese, and Korean civilizations shared was "They were neighboring countries that shared a common history."

The similarity between Japanese, Chinese, and Korean Civilizations

The three countries China, Japan, and Korea, are all in the North East of Asia.

These three countries are closer to each other geographically, and they share a common history through trade, culture, and relations.

Hence, in this case, it is concluded that the correct answer is option C." They were neighboring countries that shared a shared history."

Learn more about North Asia here: https://brainly.com/question/17006936

Answer:

c

Explanation:

What is a distinct characteristic of a
monopoly?
A good competition
B. no barriers to entry
C unfair advantage over customers

Answers

Answer:

Unfair Advantage over customers

Which statement explains why Madison thinks the Constitution would be a dead letter without this power ​

Answers

Answer:

Despite his commitment to individual liberties, Madison opposed making inclusion of a bill of rights a precondition for ratification of the Constitution. He also doubted that mere “paper barriers” against violating basic rights were sufficient protection.

Explanation:

Answer:

what are the answer choices

Explanation:

Which of the following is NOT part of our solar system?
the Milky Way
the moon
Jupiter
the sun

Answers

Answer:

The Milky Way.

Explanation:

Our solar system is part of the Milky Way, not the other way around. The Milky Way encompasses a much larger area as compared to our solar system.

Which statement describes air pollution around the world?

A.

Air pollution is a problem in every part of the world.

B.

Air pollution is only a problem in some areas over the ocean.

C.

Air pollution is only a problem in countries with many volcanoes.

D.

Air pollution is a problem in countries with industry and large populations.

Answers

Answer: D. Countries with large populations and factories have a lot of green house gasses, which cause air pollution.
Other Questions
32) 48,504 16 33) Is the sum of 15,398 + 7,292 even or odd? Why? 34) Is the product of 312,234 x 8,987 even or odd? Why? I need all of these answers by today!! Pls help right answer gets brainliest A, who travels 4 miles an hour starts from a certain place 2 hours in advance of B, who travels 5miles an hour in the same direction. How many hours must B travel to overtake A? You can change the ____ or position of text within a document's margins. a. fielding b. proportion c. location d. alignment sixty students at gillette road middle school play a winter modified sport. if there are 500 students in the middle school, what percent of students play a sport 6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD