Which of the following statements is not true about the American colonies?

Answers

Answer 1

The statement that is NOT true about the American colonies is:

"Slavery was only permitted and allowed in the Southern Colonies."

What informs slavery in the American colonies?

Slavery was allowed and practiced in all of the America, although it was most prevalent and heavily relied upon in the Southern Colonies, particularly in the plantation-based economies of Virginia and the Carolinas.

The New England colonies were settled primarily for religious reasons, the Southern Colonies were settled primarily for economic reasons, and many new immigrants chose to move to the Middle Colonies due to their cultural diversity and availability of land and jobs.

learn more about American colonies: https://brainly.com/question/457399

#SPJ1

The complete question goes thus:

Which of the following statements is not true about the American colonies?

The New England colonies were settled primarily for religious reasons.

Slavery was only permitted and allowed in the Southern Colonies.

The Southern Colonies were settled primarily for economic reasons.

Many new immigrants chose to move to the Middle Colonies due to their cultural diversity and availablity of land and jobs.


Related Questions

How was production different after the Industrial Revolution than it was
before?
OA. Before the Industrial Revolution, workers controlled the means of
production. After the Industrial Revolution, governments controlled
the means of production.
B. Before the Industrial Revolution, items were produced in cities.
After the Industrial Revolution, items were produced on farms.
C. Before the Industrial Revolution, items were produced by factory
owners. After the Industrial Revolution, items were produced by
factory workers.
D. Before the Industrial Revolution, items were produced one at a
time. After the Industrial Revolution, items were mass produced.

Answers

Answer:

D. Before the Industrial Revolution, items were produced one at a

time. After the Industrial Revolution, items were mass produced.

Explanation:

what is the united states of america

Answers

Answer:

United States, officially United States of America, abbreviated U.S. or U.S.A., byname America, country in North America, a federal republic of 50 states. Besides the 48 conterminous states that occupy the middle latitudes of the continent, the United States includes the state of Alaska, at the northwestern extreme of North America, and the island state of Hawaii, in the mid-Pacific Ocean. The conterminous states are bounded on the north by Canada, on the east by the Atlantic Ocean, on the south by the Gulf of Mexico and Mexico, and on the west by the Pacific Ocean. The United States is the fourth largest country in the world in area (after Russia, Canada, and China). The national capital is Washington, which is coextensive with the District of Columbia, the federal capital region created in 1790.

Joe McCarthy's downfall began
when he falsely accused what
branch of the United States
military of communist activity?
A. Marines
C. Air Force
B. Army
D. Navy

Answers

Joe McCarthy's downfall began when he falsely accused the United States Army of communist activity. His tactics and accusations during the Army-McCarthy hearings were widely criticized, and his popularity declined as a result. The hearings ultimately led to McCarthy's censure by the Senate and marked the beginning of the end of his political career.

Joe McCarthy's downfall began when he falsely accused the United States Army of communist activity. In 1953, McCarthy began investigating alleged communist infiltration of the Army, claiming that the Army was harboring known communists and blocking his efforts to root out communist sympathizers. He held a series of public hearings known as the Army-McCarthy hearings, during which he made a number of false and unsubstantiated accusations against Army officials.

The Army-McCarthy hearings were highly publicized and attracted widespread attention, with millions of Americans tuning in to watch the proceedings on television. However, McCarthy's tactics and accusations were widely criticized, and his popularity began to decline. The Army fought back against McCarthy's accusations, presenting evidence that discredited many of his claims.

Ultimately, the Army-McCarthy hearings were a turning point in McCarthy's career. While he had previously been seen as a powerful and influential figure, his tactics and accusations during the hearings were widely condemned. McCarthy's downfall was cemented when the Senate voted to censure him in 1954, citing his abusive behavior and misuse of power.

for more such questions on United States

https://brainly.com/question/25899399

#SPJ11

PLEASE HURRY IM TIMED
Which question can best be used to find the central idea when reading a text?
A. Why was the text written?
B. What is this text mostly about?
C. Is the text meant to inform, argue, or entertain?
D. Which words or phrases are important in the text?
This is for history somehow

Answers

Answer:

B

Explanation:

What caused voting rights to be expanded

Answers

The actions or circumstances that  caused voting rights to be expanded are Suffrage Movements as well as Civil Rights Movement.

What was Suffrage Movements  and Civil Rights Movement?

While the Women's Suffrage Movement won women the right to vote and contributed to a feeling of gender equality, the Civil Rights Movement laid the groundwork for equality and civil rights for African Americans.

Two movements battle for equal rights however the suffragettes fight for women to have the same voting rights as men, and the black people fight for equal treatment with white people.

Learn more about voting rights at;

https://brainly.com/question/28592066

#SPJ1

What was the international impact of the Sharpeville Massacre?
O South Africa faced international sanctions over apartheid after the massacre.
O South Africa received international awards for ending apartheid after the massacre.
O Countries agreed to play against South African sports teams to help improve the economy.
O Countries banned South Africa from international groups like the United Nations.​

A is the answer

Answers

The Sharpeville Massacre, which took place on March 21, 1960, led to South Africa facing international sanctions in response to the apartheid policies that were in place at the time. Hence, Option (A) is correct.

The Sharpeville Massacre took place in the township of Sharpeville, South Africa, in which South African police fired on peaceful protestors. They were protesting against the apartheid laws and policies of the white ruling class.

The Sharpeville Massacre had a tremendous international effect and sparked outrage and condemnation of the apartheid regime of South Africa.

Hence, the Sharpeville Massacre led to sanctions on the apartheid regime from all around the globe.

Learn more about  the Sharpeville Massacre here:

https://brainly.com/question/28490455

#SPJ1

What were the effects of Mao's Great Leap Forward?
O Work quotas were removed.
O Natural disasters destroyed factories.
O Farms failed to produce food.
O Farms produced excess crops.​

Answers

C, farms failed to produce food

Farms couldn't make enough food, so millions of people died from severe famine.


Which person would have been most likely to support the March on
Washington Movement in the 1940s?

Answers

the same is true with d

Answer:

The person who would have been most likely to support the March on Washington Movement in the 1940s would be a civil rights activist or someone who believed in equal rights for African Americans. The March on Washington Movement was a campaign led by A. Philip Randolph and other civil rights leaders to protest racial discrimination in employment practices by the U.S. government and defense industries during World War II. It aimed to achieve fair treatment and equal job opportunities for African Americans. Individuals passionate about civil rights, equality, and social justice would have been most likely to support and participate in the March on Washington Movement during that time.

How did the United Nations Security Council react when North Korea began developing a nuclear arms program?
O The UN took military action against North Korea to stop the program.
O The UN banned trade with North Korea and imposed other sanctions on the country.
O The UN formed a partnership with North Korea to help it safely conduct the program.
O The UN pledged military support to North Korea so the country would not need additional weapons.​

Answers

Answer: B

Explanation:

Answer: b

Explanation:

I really really need help asap please please

According to the Unit, which of the following statements could describe people who believe most of life is determined by fate ?


A.) They might feel a lack of personal control over the outcomes of life.

B.) They might make decisions based solely on the advice of other people in their lives.

C.) They may believe there is a purpose in life that is affected by free will and personal decisions.

D.) None of the statements are correct.

Answers

Answer:

A.) They might feel a lack of personal control over the outcomes of life.

This statement could describe people who believe most of life is determined by fate.

I would say A because B and C has nothing to do with fate and D doesn’t make sense because A fits the question to a tee

Olaudah equiano recalls the middle passage

Part A what is the author most likely purpose for including the dialogue in paragraph 5

Answers

Answer:

In this harrowing description of the Middle Passage, Olaudah Equiano described the terror of the transatlantic slave trade. Equiano eventually purchased his freedom and lived in London where he advocated for abolition.  "excite in [the reader's] august assemblies a sense of compassion of the miseries which the Slave-Trade has entailed on my unfortunate countrymen."   He wants the reader to know what African slaves truly experienced on a slave trip along the Middle Passage. Ultimately through his narrative, Equiano intends to persuade his audience, the British government, to abolish the Atlantic slave trade as well as alert them of the harsh treatment of slaves. Equiano was sold to the North American colony of Virginia where, in 1754, he was purchased by Lieutenant Pascal, an officer in the Royal Navy. Equiano traveled extensively and learned the mariner's trade with Pascal, who sent Equiano to London for schooling. The "middle passage," which brought the slaves from West Africa to the West Indies, might take three weeks. Equiano includes the letters to assure the reader of his strong moral character and work ethic. The letters use third-person perspective, which contrasts with the first-person voice that's used once the memoir begins. The book describes Equiano's time spent in enslavement, and documents his attempts at becoming an independent man through his study of the Bible, and his eventual success in gaining his own freedom and in business thereafter.

How do the ideals expressed in this declaration contrast with the realities of the old order in France

Answers

The ideals expressed in the Declaration of the Rights of Man and of the Citizen, which was adopted during the French Revolution in 1789, contrasted sharply with the realities of the old order in France.

The declaration proclaimed the principles of liberty, equality, and fraternity, advocating for individual rights, representative government, and the end of aristocratic privilege.

However, the old order in France was characterized by a rigid social hierarchy, absolute monarchy, and widespread inequality.

Under the old order, the French society was divided into three estates.

with the clergy and nobility enjoying significant privileges and exemptions from taxes, while the commoners, who constituted the majority of the population, faced heavy taxation and limited opportunities for advancement.

Learn more about French Revolution here:

https://brainly.com/question/5761578

#SPJ1

the end of slavery in the united states finally came after _

Answers

Answer:

look at explanation

Explanation:

after Abraham Lincoln signed the pleminary emancipation proclamation

Grade 12 gograph for 2023

Answers

grade 12 geography in 2023 will likely focus on the need for sustainable practices and the importance of protecting the natural environment for future generations. Students will need to be equipped with the knowledge and skills needed to address these pressing environmental challenges.

Grade 12 geography in 2023 will likely focus on how humans interact with the natural environment and the impact of these interactions on ecological systems. With increasing concerns about climate change, environmental degradation, and resource depletion, students will need to have a strong understanding of the causes and consequences of these issues.

One key area of focus may be on sustainable development and ways to balance economic growth with environmental protection. This could include examining the role of renewable energy sources, sustainable agriculture, and conservation efforts.

Another area of study may be on the impact of urbanization on natural systems and the need for sustainable urban planning. As more people move to cities, there is a growing need for infrastructure, transportation, and housing. This can lead to increased pollution, loss of natural habitats, and other environmental issues.

for more such questions on geography

https://brainly.com/question/12790602

#SPJ11

46
Large numbers of Holocaust survivors fought in the Israeli wars in 1948 and 1949.
AT
True
False
OA.
OB.

Answers

Large numbers of Holocaust survivors fought in the Israeli wars in 1948 and 1949. Thus, the given statement is true.

On the same day, President Truman recognized Israel as a new state. Israel promptly eliminated all restrictions on Jewish immigration. Holocaust survivors quickly started to enter the emerging State of Israel. In Israel's War of Independence (1948–1949), many survivors fought and lost their lives as soldiers.

Holocaust survivors made major contributions to Israel even though they made up a small portion of the population. Worldwide, the State of Israel continues to be a significant source of protection and pride for survivors and their families.

Learn more about Holocaust here:

https://brainly.com/question/7327413

#SPJ1

DAILY NEWS
Congress Passes Landmark
Voting Rights Act
Political Backlash
Expected in the South
The new law mentioned in the newspaper clipping above represented a
setback for those who wished to:
A. shift power to the Democratic Party.
OB. maintain segregated public facilities.
C. fight poverty among African Americans.
OD. reduce the political power of minority groups.

Answers

The new law mentioned in the newspaper clipping represents a setback for those who wished to reduce the political power of minority groups. This is evident from the context provided, where the "Political Backlash Expected in the South" suggests that the new Voting Rights Act passed by Congress would likely face opposition from individuals or groups who wanted to maintain or increase their political power by limiting the voting rights of minority groups.

Explain one way in which policing was similar in Tudor England and the early 18th century.

Answers

Sure. One way in which policing was similar in Tudor England and the early 18th century was that it was largely based on local government. In both periods, the responsibility for maintaining law and order fell to the local community, and the local sheriff or constable was the primary law enforcement officer. The sheriff or constable would be responsible for keeping the peace, apprehending criminals, and bringing them to justice.

In Tudor England, the sheriff or constable would be appointed by the king or queen, and would be responsible for a particular county or shire. In the early 18th century, the sheriff or constable would be appointed by the local magistrates, and would be responsible for a particular parish or township.

Despite some differences in the details, the basic system of policing in Tudor England and the early 18th century was largely based on local government. This system would continue to be used in England until the early 19th century, when the Metropolitan Police was established in London.

Which of these was a feature of the relationship between the Soviet Union and the United States in the era leading up to détente?

Answers

Answer:

Taking into account the statement above "Which was a feature of the relationship between the soviet union and the united states in the era leading up to détente?"

The answer is the Arms race. Hope this helps.

Explanation:

How has globalisation affects foreign policy and national interest

Answers

Globalization has had a variety of effects on foreign policy and national interests. Economic globalization has resulted in a sophisticated web of international trade and financial institutions that require others' collaboration to extend, develop, and improve.

Globalization cross-border trade in products, services, and capital can stimulate economic activity and prosperity.

Foreign globalization must prioritize international policies that will encourage job creation and allow incomes to recover; overhaul the United States' international trade agenda and ensuring it is matched with a domestic policy agenda to foster more inclusive economic growth.

As a result, the significance of the globalization impacts foreign policy and national interest are the aforementioned.

Learn more about on globalization, here:

https://brainly.com/question/30331929

#SPJ1

Which statement BEST explains the effect of the USA PATRIOT Act?

News sources were censored by the federal government.

Citizens’ privacy was limited by the federal government.

State governments gathered information about citizens.

State governments limited access to public information.

Answers

Answer:

The statement that BEST explains the effect of the USA PATRIOT Act is: Citizens’ privacy was limited by the federal government.

The USA PATRIOT Act (Uniting and Strengthening America by Providing Appropriate Tools Required to Intercept and Obstruct Terrorism Act) was passed in the United States in response to the 9/11 terrorist attacks. The act aimed to enhance national security and provide law enforcement agencies with expanded powers to combat terrorism.

One of the significant effects of the USA PATRIOT Act was the expansion of surveillance powers granted to the federal government. It allowed for increased surveillance and monitoring of electronic communications, including phone calls, emails, and internet activity. This expansion of surveillance powers raised concerns about citizens' privacy as their personal information and communication could be accessed and monitored by government agencies without explicit warrants or probable cause.

Therefore, the USA PATRIOT Act primarily limited citizens' privacy by granting broader surveillance powers to the federal government.

Explanation:

Write a children book with the topic :


The experiences of prisoners of war in World WarII,including the conditions in pow camps efforts to escape or resist captivity

9 pages

Answers

A children's book on prisoners of war in World War II should aim to educate children on the subject matter while being age-appropriate and sensitive to their emotional well-being.

However, I can provide some guidance on how to approach the topic of prisoners of war in World War II in a children's book. Firstly, it is important to keep in mind the target audience of the book and ensure that the language and content are appropriate for children. The topic of prisoners of war can be a heavy one, so it is essential to strike a balance between educating the children on the subject matter while also being sensitive to their emotional well-being.

One approach could be to focus on a specific prisoner of war's experience and tell their story through illustrations and simple language. The book could include details on the conditions in the POW camps, efforts to escape, and resistance to captivity, highlighting the bravery and determination of those involved. It is also crucial to provide context and explain why the war was happening and what the prisoners were fighting for, to help children understand the significance of the events.

know more about World War II here:

https://brainly.com/question/651584

#SPJ11

Purpose of students for free speech movement?

Answers

The purpose of the Students for Free Speech Movement was to advocate for and defend the principles of free speech and expression on college campuses.

The purpose of the Students for Free Speech Movement was to advocate for and defend the principles of free speech and expression on college campuses. The movement emerged in response to perceived limitations and restrictions on free speech rights within academic institutions.

The students involved in the movement believed that universities should be spaces that fostered open dialogue, critical thinking, and the free exchange of ideas. They argued that academic environments should encourage diverse perspectives and allow for the exploration of controversial or unpopular viewpoints.

The movement sought to challenge censorship, speech codes, and other forms of suppression of free expression on campuses. It aimed to protect and promote the rights of students, faculty, and invited speakers to express their opinions and engage in robust intellectual discourse without fear of retribution or censorship.

The Students for Free Speech Movement played a significant role in raising awareness about the importance of free speech rights and pushing for policy changes that supported greater freedom of expression within the academic community. It continues to be a vital force in advocating for the protection of free speech principles on college campuses today.

For more such question on Free Speech Movement

https://brainly.com/question/31649722

#SPJ11

How did white southerners block African American men from voting

Answers

Answer:

During the era of Jim Crow laws in the Southern United States, white southerners used various tactics to block African American men from exercising their right to vote. Here are some of the methods employed:

1. Poll Taxes: White southerners implemented poll taxes, requiring individuals to pay a fee to vote. These taxes disproportionately affected African Americans, who often faced economic hardships and could not afford the fees.

2. Literacy Tests: Literacy tests were used to assess a person's reading and writing abilities as a prerequisite for voting. These tests were often administered unfairly and with intentionally tricky questions aimed at disenfranchising African Americans with limited educational access.

3. Grandfather Clauses: Some southern states implemented grandfather clauses, which allowed individuals to vote only if their grandfathers had been eligible to vote before a particular year. This effectively excluded African Americans, whose ancestors had been enslaved and denied the right to vote.

4. Intimidation and Violence: White supremacists and groups such as the Ku Klux Klan used intimidation, threats, and violence to discourage African Americans from registering or attempting to vote. This included physical attacks, bombings, and other forms of terror.

5. Poll Watchers and Election Officials: White Southerners who held positions as election officials and poll watchers often engaged in discriminatory practices. They would subject African American voters to additional scrutiny, arbitrary challenges, and unfair questioning, making it difficult for them to cast their votes.

6. Disenfranchisement Laws: States implemented various laws and provisions, such as property ownership requirements, complicated registration processes, and residency restrictions, to make it harder for African Americans to register and vote.

It's important to note that these tactics were part of an extensive system of systemic racism and discrimination prevalent in the Jim Crow era, aimed at maintaining white supremacy and denying African Americans their constitutional rights. These measures persisted until the Civil Rights Movement of the 1950s and 1960s when significant strides were made to combat voter suppression and secure equal voting rights for all Americans.

What is the largest employer in the state of New Mexico

Answers

Answer:
US Federal Government
Explanation:
US Federal Government with 28900 employes.

How were the economic motivations for colonization different for the French and English? How did each of these approaches impact the indigenous people who lived in the American continent

Answers

Depending on the colonial strategy, the effects on indigenous people differed. Due to its emphasis on commercial relationships and cultural collaboration, French colonies had a relatively less influence. Native tribes occasionally joined forces with the French to oppose English colonists. However, English colonialism frequently brought to land expropriation, battles, evictions, and the deterioration of indigenous traditions.

The overseas colonies, protectorates, and mandate regions that were under French control starting in the 16th century made up what is known as the French colonies empire (French: Empire colonial français).

The "First French Colonial Empire," which lasted until 1814 and was mostly lost or sold by that point, and the "Second French Colonial Empire," which started with the invasion of Algiers in 1830, are often land expropriation distinguished from one another. Between the two world wars, it reached its height.

Learn more about French colonies , from :

brainly.com/question/27649724

#SPJ1

Why does Howell agree to help the Cubans for the cost of expenses only?

Answers


1. Humanitarian values: Howell may have been driven by a sense of duty to help people in need, irrespective of their nationality or background.

2. Political opinions: Howell's political opinions may have influenced his decision to support the Cubans. For instance, he may have been sympathetic to the Cubans' struggle against a repressive government.

3. International Relations: Howell may have considered the potential impact of the Cubans' struggle on international relations. For instance, he may have believed that supporting the Cubans would improve the US's standing in the international community.

4. Personal Interests: Howell may have had personal interests, such as business or social, that motivated him to offer help to the Cubans.

5. Religious beliefs: Howell may have been motivated by his religious beliefs to help those in need, which could have included the Cubans.

In context, which phrase should be replaced in vague pronoun ”them” in sentence 4

Answers

Answer:

probably they

Explanation:

They/them

The secret annex Peter wore regular clothes why do you think he continued his routine?

Answers

Sin embargo, podría suponer que mantener una rutina regular puede darle una sensación de normalidad en un entorno altamente estresante y desafiante. Además, seguir con su rutina puede haber sido una forma de mantener su salud mental y física durante el tiempo que estuvo escondido.

Explanation:

“Words . . . may become subject to prohibition when of such a nature and used in such circumstances as to create a clear and present danger.”
—Justice Oliver Wendell Holmes, Schenck v. United States, March 1919

According to this ruling,
people had the right to say whatever they wished.
people were not allowed to discuss frightening or controversial topics.
the right to free speech had limits that could be enforced by the government.
the right to free speech was overturned.
Mark this and return

Answers

According to the ruling in Schenck v. United States, the right to free speech had limits that could be enforced by the government. Thus the correct option is C.

A major Supreme Court case decided in 1919 recognized as Schenck v. United States addressed free speech rights during wartime. During World War I, Charles Schenck distributed pamphlets encouraging men to overcome the drought.

According to the decision in Schenck v. United States, the right to free expression included restrictions that the government might impose. Certain words or statements, according to Justice Holmes, could be prohibited if they posed a "clear and present danger" in specified situations.

Therefore, option C is appropriate.

Learn more about Schenck v. United States, here:

https://brainly.com/question/30563526

#SPJ1

how did kansa-nebraska act pull the nation apart

Answers

The Kansas-Nebraska Act repealed the Missouri Compromise, created two new territories, and allowed for popular sovereignty. It also produced a violent uprising known as “Bleeding Kansas,” as proslavery and antislavery activists flooded into the territories to sway the vote.
Other Questions
A nurse is caring for a client who has recurrent lower urinary tract infections (UTIS). Which of the following medications should the nurse expect to administer? A. Ganciclovir. B. Nitrofurantoin. C. AmphotericinB. D. Azithromycin. what is equivalent to 4}147 write a function called makechange() that takes in a value in cents, represented as an int and then calculates the number of quarters, dimes, nickels, & pennies needed for change a trade of securities between a bank and an insurance company without using the services of a broker-dealer would take place on the A. second market B. third marketC. fourth marketD/ first market a strong organizational culture helps people identify a businesss _____. observe the reflected ray for other angles of incidence. is the reflected ray completely polarized? partially polarized? Hi I need help with this question(4) Let f : R2 + R2 be defined by f(x, y) = (2 - x + 3y + y2, 3x 2y xy) - 2 Use directly the definition of the derivative to show that f is differentiable at the origin and compute f'(0,0). Hint: If the derivative exists, it is in L(R2, R2), so it can be represented by a 2x2 matrix. What if a person SHOULD have inherited the Normal Coding DNA fromtheir parents leading to the "trait" described by the amino acid sequence inthe protein BUT... something happened leading to the mutation shown inthe Mutant Coding DNA [Mutations highlighted Green] 1) Transcribe andtranslate the Normal DNA and tell me which trait they SHOULD haveinherited 2) Transcribe and translate the Mutant DNA and tell me whichtrait they ACTUALLY inherited. 3) Would this be an example of a "silentmutation"? Explain why or why not.You should work this out on scratch paper. Be VERY careful when copying downthe DNA (and/or writing out your mRNA sequences) to make sure you don't changethe sequence. Your answer should be a string of letters representing the aminoacids in the protein (do NOT type the mRNA sequence). The amino acid sequencewill spell real WORDS if done correctly.Normal Coding DNA AATATGCCCAGGGAAACGACATATTTTGCGTGCGAATGAMutant Coding DNA AATATGAGTATACTCCTGTATTTTGCGTGCGAATGA which statements best describe manufacturing in north carolina? check all that apply. outsourcing has resulted in a loss of jobs in the state. foreign competition has led to declining sales of products made in north carolina. the furniture industry is no longer important to north carolina. a number of textile mills were forced to shut down across the state. many furniture factories have closed in north carolina in recent years. the textile industry is in decline, while the apparel industry is on the rise. The boiling point of an liquid is 383CWhat is the melting point of the liquid?Pick the correct answer. 70 383 390 400 483 They play football (interogative) If the fatty acid 14:1^7 is completely catabolized to CO2 and H20, what would be the net yield of ATP? A) 90.5 ATP B) 92 ATP C) 92.5 ATP D) 94 ATP E) 94.5 ATP belgium, netherlands, and luxembourg make up the benelux countries(TRUE/FALSE) suppose that y is a linear function of x. increasing x by 3.7 units decreases y by 0.4 units. what is the slope? radiometric dating estimates the start of the phanerozoic at __. a recent study implemented a year-long intervention with the goal of reducing the harmful effects of violent television content on children's behavior by implementing 31 brief lessons with primary-grade children. what was the result of this research? Do you believe that J. P. Morgan was right to assume such a large role in directing the U. S. Economy? Why or why not? A company is planning to spend $100.000 now for possible replacement of the heating and cooling systems in three of its larger manufacturing plants. If the replacement won't be needed for 4 years, how much will the company have in the account, if it earns interest at a rate of 8% per year? A. $133,022,01 B. $136,048,89 C. $135,048,89 D. $146,048,98 from 1950 until 2000, the labor force participation rate has A) Identity ONE ideology that informed the author's point of view in the passage. b) Explain ONE way in which the actions of the Chilean military as described in the passage reflect the global political context of the late twentieth century. c) Identity ONE state in Latin America or Africa, other than Chile, in which global geopolitical circumstances led to political instability in the second half ofthe twentieth century