Medicine College

Which of the following is not a basic part of the human cell

Answers

Answer 1

Answer:

Which would be Cell Wall

Explanation:

Answer 2
The answer is a cell wall

Related Questions

Which of the following is a sub-goal for preventing infection in ambulatory care programs? A. Use guidelines to prevent infections after surgery. O B. Use guidelines to prevent infections of the blood from central lines. O C. Develop and use guidelines to prevent difficult to-treat infections. O D. Use guidelines to prevent infections of the urinary tract caused by catheters​

Answers

Answer:

C. Develop and use guidelines to prevent difficult to-treat infections.

Explanation:

I think thats it sorry if its not :/

Yeast is a living
It is used as a
which is a gas
agent used to make dough rise. As it eats sugar it releases
given off as a by product; this process is called proofing. When yeast is dissolved the
If
temperature of water is very important. If it's too cold, the yeast will not
the yeast. In order for yeast to grow, we must
the water temperature is too hot, it will
meet three conditions for growth.

Answers

Answer:

It makes pastries rise

Explanation

"As more and more tiny air cells fill with carbon dioxide, the dough rises and we're on the way to leavened bread. Yeast cells thrive on simple sugars. As the sugars are metabolized, carbon dioxide and alcohol are released into the bread dough, making it rise."

And how is this a question?

can you fit a raccoon in your bu11hole mathematically

Answers

Answer:

yes

Explanation:

as the anus can stretch up to 7 inches, a raccoon and fit within that size hole, as they can fit into a hole as small as 3-4 inches. so hypothetically you could probably fit 2 raccoons in there.

Answer:

technically you can stretch your 10 inches wide so yea

Stress can be best defined as

Answers

Answer:

Stress is the body's reaction to any change that requires an adjustment or response.The body reacts to these changes with physical, mental, and emotional responses..

Explanation:

Which fnaf character is the scariest?

A. Springtrap Fnaf 3
B. Golden Freddy Fnaf 1
C. Nightmare Fnaf 4
D. Ennard Fnaf Sister Location
E. Circus Baby Fnaf sister location
F. Mangle Fnaf 2

Answers

Answer: G. all the above

Springtrap if not Nightmare

Other Questions
What is a similarity and a difference in European exploration of the East and of the West? One thing all the delegates had in common WILL MARK BRAINLIEST IF CORRECT PLEASE HELP!!Which graph represents this system?y = one-half x + 3. y = three-halves x minus 1A. On a coordinate plane, a line goes through (0, 3) and (4, 5) and another goes through (0, negative 1) and (2, 2).B. On a coordinate plane, a line goes through (0, 3) and (1, negative 3) and another goes through (0, negative 1) and (3, 1).C. On a coordinate plane, a line goes through (negative 1, negative 2) and (1, 4) and another goes through (0, 1.5) and (1.5, 0).D. On a coordinate plane, a line goes through (negative 3, negative 3) and (0, 3) and another goes through (0, negative 1) and (3, 1). I neeed help pleaseeee GUse the graph to answer the question.y6R543-21O3What are the coordinates of point R on the graph? Choose numbers to move to the lines to answer the question,56012 I need answer as quick 0.45 g of hydrated sodium carbonate crystals were heated until 3.87 of anhydrous power remained.How many moles of water are there in one mole of hydrated salt? Will mark as brainliest!!!!!!!!!! X3.1.PS-7QuestionA local little league has a total of 60 players, of whom 40% are right-handed. How manyright-handed players are there? what do you divide (-2/3) with to get 3/10 The sum of the tens digit and the hundreds digit of a number is three times the units digit. 1/5 of the sum of all three digits is 1 less than the units digit. Find all three-digit numbers that satisfy these conditions. Which of the following sentences is not punctuated correctly?A. She was the sweetest and most generous person I have ever met.B. This is the last long boring class I have left today.C. Dallas is a huge and sprawling city.D. Instead of carrying guns, the police in Britain carry long, metalnightsticks.SUBMIT Harder equationsSolve these equations:3x + 3 = -6. X= AABB Rhythm poem christmas themed. pls can you make 3 stanza of AABB poem. pls help me what is the role of the grana in chloroplast? Which of the following will NOT help reduce the costs of car ownership? A. Carpooling and safe driving B. Performing maintenance tasks on your own C. Speeding D. All of the above A school has 617 students. Each class has between 28 and 32 students. Which is the best estimate of the number of classes in the school?14 classes20 classes30 classes60 classes Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50