Answer:
A population of mosquitoes develops resistance to a pesticide
Explanation:
Evolution can be defined as the way the characteristics of a species change over several generations. This process relies on natural selection - a mechanism in which individuals that are better adapted to their environment survive and reproduce most successfully.
A population of mosquitoes developing resistance to a pesticide is an example of adaptation. This is how mosquitoes become adapted to their environment and increase their chances of survival. Eventually, most of the mosquitoes will be resistant thanks to natural selection. This is how mosquitoes evolve.
This is why the fourth option is the correct one.
What number go in each circle ?
What number go in both circle?
Answer:
1 goes in the middle of all of the circles. 2 goes in animal cell. 3 goes in plant cell. 4 goes in between animal and plant cell. 5 goes in The middle of all of the circles. 6 goes in the middle of all of the circles. 7 goes in the bacteria circle. 8 goes in bacteria. 9 goes in bacteria.
Also:
8 and 9 I'm not completely sure of. Let me know if I'm wrong. Good Luck! :D
What are two ways in which cells use the energy temporarily stored in ATP?
Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways
The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.
What is Active transport?
Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.
ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.
Learn more about ATP here:
https://brainly.com/question/14637256
#SPJ2
Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another
answer: yes
exanation:
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Give SOME EXAMPLES OF NATURAL CYCLE CHECKPOINTS .
Answer:
For example, delays in mitosis are often ascribed to 'activation' of the mitotic checkpoint, a descriptor that fails to recognize that the checkpoint by definition is active as the cell starts mitosis. Conversely, the completion of mitosis in the presence of misaligned chromosomes is often automatically interpreted to indicate a defective checkpoint, even though in the absence of critical testing alternative interpretations are equally likely. In this article, we define the critical characteristics of checkpoints and illustrate how confusion generated by the inconsistent use of terminology may impede progress by fostering claims that mean very different things to different researchers. We will illustrate our points with examples from the checkpoint that controls progression through mitosis
Explanation:
Answer:
Below
Explanation:
G1 checkpoint, also known as the Start or restriction checkpoint or Major Checkpoint; the G2/M checkpoint; and the metaphase-to-anaphase transition, also known as the spindle checkpoint.
I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)
In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.
Answer:
Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.
I tried my hardest and this is what I put on MY test so good luck
A group of students studied heat transfer by placing a hot block of metal into a Styrofoam cup of room temperature water what method of heat transfer with the student studying
Radiation
Convection
Conduction
Thermal energy
Answer: Thermal Energy
Explanation:
i worked it out tell me if im right
Method of heat transfer which is being studied by the student is thermal energy.
What is thermal energy?
Thermal energy is defined as a type of energy which is contained within a system which is responsible for temperature rise.Heat is a type of thermal energy.It is concerned with the first law of thermodynamics.
Thermal energy arises from friction and drag.It includes the internal energy or enthalpy of a body of matter and radiation.It is related to internal energy and heat .It arises when a substance whose molecules or atoms are vibrating faster.
These vibrating molecules and atoms collide and as a result of which heat is generated in a substance , more the collision of particles , higher is the thermal energy. There are 3 types of thermal energy 1) conduction 2) convection 3) radiation
Learn more about thermal energy,here:
https://brainly.com/question/11278589
#SPJ2
"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?
Answer:
by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species
Explanation:
The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).
When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?
A. “action” and “reaction”
B. “mass” and “inertia”
C. “inertia” and “force”
D. “force” and “acceleration”
Answer:
A. action and reaction
Explanation:
the third law is:-
Every Action has it's opposite and equal Reaction
Answer:
The correct answer is "action" and "reaction".
Explanation:
Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.
plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion
HELP ME PLSSS someone
How does soil erosion affect streams and rivers?
Explanation:
The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.
Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.
Answer: possibly A
Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.
6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia
Answer:
Desert mole excretes concentrated urine with urea.
Marine fish excretes urine with uric acid.
Tilapia excretes dilute urine with amino acids.
Explanation:
The nitrogenous wastes that are excreted by the following organisms are as follows:
Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids. What is Nitrogenous waste?Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.
Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.
While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.
Therefore, it is well described above.
To learn more about Nitrogenous waste, refer to the link:
https://brainly.com/question/9517408
#SPJ2
in which direction do particles in a solution move during passive transport
During the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending. The passive transport is seen in the cell too.
What is the importance of the different types of transportation?In the cell, different types of transport are seen, such as active transport and passive transport; in active transport, energy is used, while energy is not used in passive transport. The movement of molecules across the cell plasma membrane is important because it allows cells to get rid of unwanted molecules. Passive transport does not require energy, and many nonpolar small molecules and gases can cross the lipid plasma membrane barrier and go into and out of the cell while, in this passive transport process, they save the cell's energy.
Hence, during the passive transport, the particles move from a higher concentration to a lower concentration without the need for energy expenditure or spending.
Learn more about the different types of transportation here.
https://brainly.com/question/29764225
#SPJ6
which of the following is not true about an allele?
A. alleles are found at the same place on a chromosome
B. alleles have a dominant and recessive form
C. an allele is never independently assorted and passed down randomly
D. and allele is one of two or more forms of a gene
Answer:
C
Explanation:
I guess it's C but not conform
C. An allele is never independently assorted and passed down randomly.
What is an allele?Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.
However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.
Learn more about allele, here:
https://brainly.com/question/14206531
#SPJ2
4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases
Answer:
The answer is A
Explanation:
am 100% sure
If you have a viral infection, why should you cover your mouth when you sneeze? * To prevent other people from breathing in the viruses you expel To prevent viruses from infecting cells in your nose and mouth To keep as many viruses as possible in your own body To get all of the cold viruses out of your body and onto your skin.
Answer:
To prevent other people from breathing in the viruses you expel
Explanation:
CORRECT
Which is an example of the use of plants in human societs?
Answer:
|
v
Explanation:
photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.
An air mass that originates over land in Central America is most likely
Answer:
An air mass that originates over land in Central America is most likely warm & dry.
Explanation:
Answer:
Warm and Dry
Explanation:
A P E X answer
The movement of water in or out of the cell membrane without the use of ATP.
Diffusion
Facilitated diffusion
Osmosis
Excoytosis
What is a likely reason for the change from mitosis to meiosis during reproduction under these conditions?
Mitosis and meiosis are the two types of cell division, which result in the generation of daughter cells. Yeasts are capable of undergoing meiotic and mitotic division under favorable conditions.
The correct answer is:
Option B: Crossing over genes during meiosis increases diversity and the chance of survival of the next generation.
The significance of meiosis can be explained as:
Meiosis is a reduction division, in which the diploid parent cell gives rise to haploid daughter cells.The crossing over of the genetic material of the haploid cells leads to genetic diversity and a higher rate of survival.Meiosis leads to genetic diversity as the data in the parent cells are fused and recombined to give rise to new offspring.Thus, meiosis is an important step in the genetic variation and survival of the organism.
Therefore, option B is correct.
To know more about meiosis, refer to the following link:
https://brainly.com/question/11622266
What are common changes
In an environment?
Answer:shelter, land, prey
Explanation:
Pls I need badly help
Answer:
medusa
Explanation:
can u answer that question
Answer:
The synthesis of new proteins
what is a cell membrane?
Answer:
The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.
Explanation:
Answer:
Short. The semipermeable membrane surrounding the cytoplasm of a cell.
Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.
Explanation:
describe and explain how the rate of photosynthesis is affected by light intensity
1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False
Answer:
False.
Explanation:
Peer review provide others scientist in the field to assess a scientist's investigations and results.
Peer Review:
It is the reviewing or evolution of the work by many professionals and experts in the field.
For example- A scienfic manuscript is send to the many scientist for evolution before publication.
This peer review is unbiased because the reviewer does not know the name or other information about writter.
To know more about Peer Review:
https://brainly.com/question/10853815
For each of the following nitrogenous base sequences, write the complimentary sequence on the line provided.
a) A – T – C – C – T – A – G – A – A – G – G – T __________
b) C – G – T – T – G – C – A – G – A – A – C – T __________
c) T – A – C – G – G – A – T – C – G – T – C – A __________
What is the series of processes in which a plant converts sunlight into a useful simple sugar called?
division
choloplasts
photosynthesis
mitosis
Answer: Photosynthesis
Explanation: I had this question to and it should be correct. I’m sorry if not.