Which of the following are responsible for the production of cancer cells?
A. oncogenes
B. mucin
C. tumor suppressor genes
D. cytosol

Answers

Answer 1

Answer:

The answer is C, tumor suppressor genes


Related Questions

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

plz help me i beg of you!???

Answers

Answer:

Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.

Explanation:

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

MARKING PEOPLE AS BRAINLIDT IF CORRCET

True or False: Bone cells contain different DNA than blood cells.

Answers

Answer:

True the bone cells do have different DNA than blood

Explanation:

True.
bone cells and blood cells do different things, hence the different DNA

which of the following are part of the central nervous system?​

Answers

Answer:

The central nervous system is made up of the brain and spinal cord

Explanation:

ion if that's the answer you were looking for but here go.

During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply​

Answers

Answer:

hi love you have a nice day      

Explanation:

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

What is meant by enzyme specificity?

Answers

Answer:

Specificity is the ability of an enzyme to choose exact substrate from a group of similar chemical molecules. The specificity is actually a molecular recognition mechanism and it operates through the structural and conformational complementarity between enzyme and substrate. Enzymes show different degrees of specificity towards their substrate.

Explanation:

Answer:

The ability of enzyme to bind with specific substrate or catalyze a specific set of chemical reactions,is called "Enzyme Specificity

the combination of a heart arteries and veins and capillaries is____​

Answers

Answer:

A (an organ system)

Explanation:

which type of cell does the strainer best model?

Answers

Answer:

D

Sieve tube element, because it has openings that allow materials to pass through its end walls.

Answer:

D. Sieve tube element, because it has openings that allow minerals to pass through its end walls

Explanation:

I'm taking the test right now, I hope this helps

explain how water properties help get water from the roots of plants to leaves

Answers

Answer:

In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.

Explanation:

what tissue breaks down food for energy

Answers

Answer:

When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.

What is the independent variable?

What is the dependent variable?

Answers

Answer:

the independent is the age of the tree and the dependent is the diameter

Explanation:

the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is

Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)

The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.

Whats the answer giving brainliest HELP!!!!!

Answers

Answer:

I feel like the first one is the best

Explanation:

widening the roads will just cause more cars.

raising the price is most likely not gonna help but its an option.

expanding just means more cars

Can DNA leave the nucleus ?
Yes
Or
No

Answers

No it never leaves the nucleus, that's wear it is located

What is the main purpose of the light reactions?

Answers

Answer:

The overall purpose of the light-dependent reactions is to convert light energy into chemical energy. This chemical energy will be used by the Calvin cycle to fuel the assembly of sugar molecules.

To create ATP and NADPH to be used in the calvin cycle.

Explanation:

Hoped I helped please mark me brainliest!!

An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as

Answers

Answer:

This organism is best classified as an autotroph.

Explanation:

Autotrophs can make their own food.

In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration

Answers

Answer:

D. In mitochondria, during cellular respiration.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.

Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.

Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.

In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.

Answer:

D

Explanation:

got it right on edge

Pls help :)) worth 10 points (:

Answers

Answer:

A

Explanation:

just go for A

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

Desert plants and animals are adapted to the lack of what and high

Answers

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible

Answer:

lack of water and high concentration of heat and dryness

Explanation:

Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.

hope this helped:)

in what form is carbon found in the atmosphere?

Answers

Answer:

carbon dioxide(CO2)

Methane gas(CH4)

Explanation:

Answer:

CO2

Explanation:

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA

Answers

Answer: Complementary base- pairing creates a very stable structure

Explanation:

The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.

A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.

In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).

Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.

Read more: https://brainly.com/question/19755749

pls answer correctly

Answers

Answer:

2nd answer bubble. or the letter B

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

a doctor sees a patient who has kidney failure, lack of motor coordination, and a poorly functioning nervous system. after testing the doctor finds that these symptoms are all related to a chronic lack of energy in some of the patients cells. the doctor diagnoses a metabolic disorder known as leigh's disease. Based on evidence a malfunction in what organelle is most likely responsible for leighs disease?

Answers

prerenal inflammation im pro

bably wrong i just wanted to answer something

A botanist finds that when compared to pink flowers, the population of purple flowers is very high. Ten years later, the population of purple flowers is nearly gone, and the number of pink flowers has tripled. Why would this be?

Answers

Answer:

Because of the reduction or near extinction of the purple flowers noticed by the botanist Ten years after it was in abundance, this fall in the population could be caused by the unfavorable change in the plant's environment. While the pink flowers tripled because some factors in the environment were favorable for its growth.

Explanation:

From the question, it was mention that the botanist noticed at first purple flowers had more population than the pink flowers and that changed after 10 years when the population of the pink flowers tripled and purple flowers were nearly gone. Some of the causes that could be responsible are:

1. Disease and pest attack on the purple flowers.

2. The pink flowers developed a good survival mechanism even in adverse conditions.

3. Environmental stress could also come into play on the purple flowers.

4. Climate which initially supported the growth of the purple flowers had changed. Because variations exist in plants and the ideal conditions necessary for plant growths and proliferation varies among plants.

.

Other Questions
In function for every input there is exactly one output What was the result of the second Continental congress? If the reserve ratio is 5 percent, then $500 of additional reserves would ultimately generate:________ Jayanti takes shortest route to her home by walking diagonally across a rectangular park. The park measures 60 meters 80 meters. How much shorter is the root across the park than the route around its edges?Pls help!!! It's due today in about 6 hours!!!!! I would also like a proper explanation instead of the answer itself!!!! 25 points!!! please Which types of elements areconsidered neutraland Where are these types of elements found on the periodic table A8B7DCD = [?] Explain how the characters of Jem and Scout develop over the course of To Kill a Mockingbird. include evidence from the text. Use quotation marks and right the page number. plz help If 3.5 waves have a distance of 42M what is the wavelength of one wave?Please please please tell me how you exactly found the answer!! Given=42and=16, find DG. (help fast please)A. 38.8B.26.4C.44.9D.13.6 Like segment PLEASE HELP MEEEEEE PLEASEEEE HELPPPP 10th GRADE GEOMETRY!!! hysteria: characteristics and examples If the radius is 52 inches, what is the diameter? Please answer this correctly without making mistakes Use long division to solve for n. 6,588 4 = n please help ........ What was the basic feature of a ROYAL colony in British Colonial America? A. The King issued a royal charter to allow the colony to exist.B. A group of refugees fled another country (ex. Pilgrims) and figured out self-governance.C. A group of prisoners were shipped there and told to figure out how to govern themselves.D. None of the above True or False A Dynasty is not a line of hereditary rulers of a country that usually lasted for hundreds of years. Use the distributive property to remove the parentheses.2(x-9) y=3x7 Complete the missing value in the solution to the equation. (1,_)