Which issue is among those addressed by Articles VII–VIII?

constitutional amendments
elections
separation of powers
taxation

Answers

Answer 1

Answer:

C

Step-by-step explanation:

Answer 2

Answer:

c <3

Step-by-step explanation:

have a blessed day <3


Related Questions

Someone plz help me have a great day ツ

Answers

Answer

What’s your scratch username

Answer:

11 weeks and 3 days

i need help again><><><><>

Answers

First thing first your gonna have to find the area of the triangle within the rectangle.

Area of triangle = 1/2 b x h
= (1/2 9) x 4
= 4.5 x 4
= 18 cm square


Then after finding the area of the triangle your gonna find the area of the rectangle.

Area of rectangle = length x width
12 x 4 = 48
= 48 cm square


Then your gonna subtract the area of the triangle from the area of the rectangle.

Area of rectangle = 48 cm square
Area of triangle = 18 cm square
= 30 cm square

So the shaded region is 30 cm square

HELP I NEED HELP ASAP

Answers

Answer:

A

Step-by-step explanation:

Process of elimination shows that the most reasonable answer is A.

A bag contains eleven balls labeled 1 through 11. One ball will be randomly picked. What is the probability of picking a multiple of 3? Write your answer as a fraction in simplest form.​

Answers

Answer:

3, 6, 9 (the multiples of three within 11)

3 out of 11 numbers are multiples of 3

so you have a 3 out of 11 probability to grab a multiple of three

3/11 is your answer

Step-by-step explanation:

Probability of picking a ball of multiple of 3 is equals to (3/11).

What is probability?

" Probability is a mathematical expression which represents the ratio of number of favourable outcomes to the total number of outcomes."

Formula used

Probability = [tex]\frac{Number of favourable outcomes}{Total number of outcomes}[/tex]

According to the question,

'B' represents the ball

Possible outcomes = { B₁, B₂, B₃, ...., B₁₀, B₁₁}

favourable outcomes multiple of 3 = { B₃, B₆, B₉}

Total number of outcomes= 11

Number of favourable outcomes = 3

Substitute the value in the formula we get,

Probability of picking ball multiple of 3 = ( 3 / 11)

Hence, probability of picking a ball of multiple of 3 is equals to (3/11).

Learn more about probability here

#SPJ2

please help i need to raise my grade

Answers

Answer:

use brainly

Step-by-step explanation:

construction worker’s planned to secure a tall pole using two cables attached to the pole at a point 12 m above the ground as shown in the diagram below.
based on the information in the diagram which value represents the total length of the cable that is needed to secure the pole?

Answers

Answer:(24+12\3)m

Step-by-step explanation:

The sum of two numbers is 4. The larger number is 12 more than three times the smaller number. What are the numbers?

Answers

Step-by-step explanation:

So, we will take one of the numbers = x

And the other is 12 more than 3 times it, so = 3x + 12

So they said if we add them, we will get 4

So x + (3x + 12) = 4

4x + 12 = 4

4x = 4 - 12

4x = - 8

x = - 8 ÷4

x = - 2

So one of the numbers x = - 2

The other is 3x + 12

So x = - 2

3x +12 = 3(-2) + 12

= 6

So the 2 numbers = 6 and - 2

Lets check!

6 + (-2) = 4

So it's right!

1,958.55 divided by 15?????

Answers

answer is 130.57
uwu

BRAINLEST answer !!


Find the value of y


Answers

Answer:

6 it's the same as the one next to a and b that's also 6

The ratio of males to females was 4:5. If there are 180 people at the fair how many males
are there?

Answers

9514 1404 393

Answer:

  80

Step-by-step explanation:

Let m represent the number of males. Then you have ...

  m/(180 -m) = 4/5

  5m = 4(180 -m) . . . . cross multiply

  9m = 720 . . . . . . . . add 4m, simplify

  m = 80 . . . . . . . . . . divide by 9

The number of males at the fair was 80.

A crane lifts a pallet of concrete blocks 7ft from the back of a truck. The truck drives away and the crane lowers the pallet 11ft What is the final position of the pallet relative to where it started in the back of the​ truck?

Answers

Answer:

The position of the concrete relative to its initial position is 4ft behind its initial position

Step-by-step explanation:

Let us analyze the problem following the sequence of events.

First of all, the crane is initially 7 ft from the back of the truck.

Once the truck drives away, the crane lowers the concrete at 11 ft away from the back of the truck.

To get this distance relative to the initial position, we have to subtract the initial position from the final position of the concrete.

This will  be

11ft - 7ft = 4 ft

The position of the concrete relative to its initial position is 4ft behind its initial position

Which table represents the statement a draft friends at a rate of 32 mph

Answers

Answer:

A.

Step-by-step explanation:

Answer: it is the first choice

A board game uses a bag of 105 lettered tiles. You randomly choose a tile and return it to the bag. The table shows the number of vowels and the number of consonants after 50 draws. Predict the number of vowels in the bag.

This is what the table says:

Vowels Consonants
18 32

Answers

Answer:

38

Step-by-step explanation:

thats the answer

Simplify the exponential expression 48 Superscript one-half.

2 (24 Superscript one-half Baseline)
3 (16 Superscript one-half Baseline)
4 (3 Superscript one-half Baseline)
16 (3 Superscript one-half Baseline)

Answers

Answer:

the answer is C here you go for anyone needing it

Step-by-step explanation:

Answer:

The answer is C. (2)

Step-by-step explanation:

Plz help and I will give brainliest

A family wants to save $100 each month. They record their progress toward this goal at the end of each month. In January they saved $120 and recorded 1$20 at the end of the month. What should they record for the month of February if they only saved $80 that month? Explain.


If you put anything random as the answer I WILL report

Answers

Answer:

200 dollars

Step-by-step explanation:

Answer:

$200.

Step-by-step explanation:

$200 because if they save $120 then $80, $200.

(120+80=200.)

Hope this helps plz hit the crown :D

sorrry for not answering earlier

i’ll give u brainliest!!
what is the area of shape 1, 2 and 3

Answers

Answer:

Shape 1: 25.915

Shape 2: 102.85

Shape 3: 142

Step-by-step explanation:

For shape 1, you have to divide 7.1 to get half the width of the triangle. You get 3.55 from that, and then finding the triangle itself you have to do 7.3*3.55 to get 25.915. For shape 2, you first do the harder parts (the triangles) and since there is two of them we don't need to half the width of each triangle. But first to get the width, we need to do 20-17.4=2.6. But since there are 2 triangles we need to divide that by 2 to get 1.3. Then you multiply that by 5.5 to get the final area of both triangles which is 7.15. Next you simply find the rectangle which is 17.4*5.5=95.7. You add the triangles area to get 102.85. Finally for shape 3 you simply do 7.1*20=142.

Answer:

after u get ur answers, u add up all the numbers to get ur total

Step-by-step explanation:

round 2.33459 to the hundreths place

Answers

Answer:

2.33

Step-by-step explanation:

Answer:

go to your hundredths place. since 4 is not greater than 5 then it would round down. so the final answer would be 2.33

For smart ppl who are good at graphs, inputs, and outputs.

Answers

Answer:

I believe the output is f(6) is -1, the output of f(2) is -4, and f(x)=-4 has the outputs of  2, 4, 8, and 10.

I think.

Jacob paid $89.59 for a portable e-book reader plus 9% tax. What is the cost of the
e-book reader including tax?

Answers

Answer:

$97.65

Step-by-step explanation:

$89.59 + $8.06 = $97.65

help pleaseeeeeeeeeeeeeeeeeeeeeeeeeeeee

Answers

Answer: C. 1 - x

Step-by-step explanation:

1/100 = 0.01

10/100 = 0.1

1 - 100 = -99

10 - 100 = -90

Answer:

C

Step-by-step explanation:

A. 1/100

B. 10/100=1/10

C. 1-100=-99

D. 10-100=-90

A newly planted tree is supported with a 6-m wire. The wire is attached 3
m up the tree. How far from the base of the tree is the wire secured to the
ground? Express your answer to the nearest tenth of a metre.
PLEASE HELP
ILL GIVE BRAINLIEST AND LOTS OF POINTS BTW

Answers

Answer:

I have the same question but no one will help me they are mean

Step-by-step explanation:

A cone has a diameter labeled twelve centimeters and a height labeled thirty-two centimeters. Find the area of a vertical cross section through the center of the base of the cone.

Answers

Answer:

[tex]A=0.0192[/tex]

Step-by-step explanation:

Diameter labeled twelve centimetres D =12cm => 0.12

height labeled thirty-two centimetres H= 32cm => 0.32

Generally the vertical cross section of this cone is a triangle

Mathematically solving

Area of vertical cross section through the center of the base of the cone is given by [tex]A=1/2 D*height[/tex]

[tex]A=R*H[/tex]

Therefore

[tex]A=\frac{0.12}{2} *0.32[/tex]

[tex]A=0.06 *0.32[/tex]

[tex]A=0.0192[/tex]

I need help please help me number 3 and 4

Answers

3. is 10 add 5 or round 5 its 10  4. is 28 and i just added sorry if 4 is wrong

What do we call a number that when we squared the result is negative?

Answers

Answer:

imaginary numbera

Step-by-step explanation:

Result of every natural number is positive and for imaginary number sqaure result positive .

-6k+7k
So I'm not sure that it's k because I need to simplify? Can someone help me

Answers

Answer:

k

Step-by-step explanation:

its just k, since 1k can be simplified to just k

It’s K since 1k equals K times 1 which equals k

A lake is 3/4 mile wide. Chandler sailed 4/5the width of the lake How far did Chandler sail ​

Answers

Answer:

1/6

Step-by-step explanation:

Chandler sailed 1/6 of the lake

Answer:

About .6 or 3/5 simplified

Step-by-step explanation:

At Shop and Save Grocery Store, apples cost $3.59 a pound. If you buy 2.5 pounds, how much will it cost? Round your answer to the nearest cent.

Answers

Answer:

$8.98

Step-by-step explanation:

3.59+3.59+1.80

The answer would be $8.98. If each pound of apples costs $3.59 cents and you buy 2.5 pounds, your equation would be 2.5(3.59)=8.98.

8x =35 what is the value for xx that makes the equation true?

Answers

4.375 - you divide 35 by 8
Divide 35 by 8 and then you get the answer

What is c? 1/3c = 3/8;c=3/4

Answers

Answer:16

Step-by-step explanation:

U just mu

70 is 40% of what number?​

Answers

oh oh i had this question jn leh me find it !!!

Answer: 175

Step-by-step explanation:

If you take 100(as a percentage) and divide it by 40, you get 2.5, 70x2.5 is 175

Other Questions
A company provides commisssion to its agent at the following rate.-0.5% in the sale upto Rs.15 lakh-1% in the sale from 15 lakh to Rs.25 lakh-1.5% in the sale from Rs.25 to Rs.40 lakh-2% in the sale above Rs.40 lakhcalculate the amount of commission that can be obtained from the following sale amount by using the above rate of commissiona.Rs.12 lakhb.Rs.24 lakhc.Rs.38 lakhd.60 lakh Please help me ASAP Which expression is equivalent to 4s + 3 - 3 - sA. 3s + 6B. 4s + 0C. 3sD. 3s + 1 Can anyone give me 1-2 sentences for an opening to a story relating to this picture? Will give brainliest for the best one:) Select the correct answer.Which group of words from the selection conveys the author's tone about his topic?A.alarming, dark, pessimistic B.valluring, complex, refreshingutC.creative, simplistic, optimisticD.critical, downtrodden, foreboding Explain in a short sentence how you can tell if a reaction is a synthesis reaction. PLEASE HELP MEEEEEEPlease choose any the book you want. Here are the questions1.Do any of the characters remind you of someone in your life?2.Who and how? Helppppppppppppppppppp Why were some people angered by the slogans printed on two of Old Navy's T-shirts? What equation could be written for this table? EnglishUsing context clues, which statement best defines theeseiverlowst riverphrase "cradle of Chinese civilization"?O. the place where the longest river in China startsO the place where most people in ancient China livedO the place where people in China began a farmingcultured forreaO the only place in ancient China where people couldfarm 2 examples of peer pressure in The Sneetches What is the value of s? How do the dwarfs react to Snow White's appearance in their home?A: The dwarfs demand that Snow White leave the cottage and return to the woods.B: The dwarfs are relaxed because they are used to visitors.C: The dwarfs admire her beauty and leave her undisturbed.D: The dwarfs are angry when they realize that their beds have been slept in. What is the shrine of Texas Liberty? ILL GIVE BRAINLYIn this political cartoon, created by Benjamin Franklin as the French and Indian War began, what do the parts of the snake represent?A. colonies bordering Spanish territoryB. French colonies in North AmericaC. The Southern ColoniesD. English colonies in North America In what ways was the Hundred Years War a new kind of war A: it was caught between nations that were becoming unified states B: it was fought between two religions. Christianity and Islam. Rather between different countries. Find the value: 3/2 5/8 (write your answer as a fraction AND as a decimal number) decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA what is 0.41891891891892 to two significant figures?