where was the first confrontation between the minutemen and british troops

Answers

Answer 1

Answer:

Explanation:

The Battles of Lexington and Concord, fought on April 19, 1775, kicked off the American Revolutionary War (1775-83). Tensions had been building for many years between residents of the 13 American colonies and the British authorities, particularly in Massachusetts.


Related Questions

1) Which of these was one of the few successes of the United States government under the Articles of Confederation? es A) A well trained military force was created. B) Great Britain became a strong military ally. There was a great increase in factory output. D) Agreements were made to help settle western lands.​

Answers

One of the few successes that the U.S. government saw during the era of the Articles of Confederation was that D) Agreements were made to help settle western lands.​

As a result of the Articles of Confederation:

The Northwest Ordinance was signed

This ordinance was very important because it provided the blueprint for how western and northwestern territories would be divided into states as well as rights of Americans in those territories.

In conclusion, the Articles allowed for land to be organized in the west.

Find out more on this at https://brainly.com/question/621589.

Please help! WILL MARK BRAINLIEST
( NO LINKS )

Answers

Answer:

Tea tax caused the boston tea party, proclamation caused ban on west expansion, military presence caused boston massacre, stamps act caused taxation and the french and indian war caused protests

Explanation:

What was the challenge caused by california entering the union?

Answers

Answer:

There was a huge increase in population and a pressing need for civil government. In 1849, Californians sought statehood and, after heated debate in the U.S.

Hope that helped?

Which of the following matches is incorrect? *

Aphrodite = goddess of wisdom
Priam = king of Troy
Odysseus = king of Ithaca
Menelaus = king of Sparta

Answers

The answer would be Aphrodite, she's the goddess of beauty and sexual love.

Claiming that it would force an unhealthy alliance between the government and wealthy businesses interests many argued the Constitution made no provision for a _____________.

Need ASAP
will give brainliest

Answers

For a individual.
That’s the answer

What advantage did Sparta have over Athens in the Peloponnesian War?

Answers

Answer:

Athens were trapped in their own walls and had no cleanliness. and a plague broke out causing 1/3 of the Athens to die

what does the Atlantic Motel v. U.S. reflect?

Answers

The landmark Supreme Court case involving Civil Rights under the Commerce Clause is Heart of Atlanta Motel v. United States, decided December 14, 1964. The Supreme Court held that the government could enjoin private businesses from discriminating on the basis of race under the Commerce Clause.

who was the last prophet of Islam?​

Answers

Answer:

Assalamualikum , According to the Authentic Hadith the last Prophet Of Islam is Hazrat Muhammed Mustafa ( sallahualihi wasallam )

Explanation:

why did the british issue the proclamation of 1763

Answers

Answer:To force native Americans to relocate west of the Mississippi River

Explanation:

Why couldn't we “provide for the common defense" before the Constitution?

Answers

How does the Constitution provide for common defense?

provide for the common Defense. Congress appropriates funds for national defense and has the power to declare war. By approving international agreements and the appointment of ambassadors, Congress also supports efforts to resolve conflict through diplomacy.

Hoped that helped:)


What’s a central government and it’s purpose?

Answers

Answer: a central government is national government from a single important city rather than local government.

Explanation: its purpose is to oversees finance, commerce, national defense, foreign affairs, and all laws 'necessary and proper'.

What advantage did Sparta have over Athens in the Peloponnesian War?

Answers

Answer:

An advantage of Sparta in the Peloponnesian War was its powerful army, and an advantage of Athens was its great wealth. However, Athens's army was also strong, and Sparta had some strategic limitations. In addition, the Athenian political system proved to be a critical weakness as well, prone as it was to turmoil and instability.

Explanation:

which countries were under control of the roman empire by 125 ad

Answers

Answer:

England, Wales, France, Spain, Portugal, Belgium, Switzerland, Austria, Italy, Hungary, Rumania, Turkey, Greece, Albania, Yugoslavia, Israel, Lebanon, Tunisia and parts of Germany, the Soviet Union, etc.

Abraham Lincoln once joked that the following person started the Civil 4 points
War because of his/her writing. *
a. Harriet Beecher Stowe. b. Ulysses S. Grant
c. Clara Barton
d. Frederick Douglas

Answers

Based on historical perspective, Abraham Lincoln once joked about Harriet Beecher Stowe starting the Civil War because of her writing.

Harriet Beecher Stowe

Harriet Beecher Stowe was an American author and abolitionist. She was famous for her book titled Uncle Tom's Cabin, which depicts the harsh conditions of the many enslaved people in America.

In 1862, when Abraham Lincoln met Harriet Beecher Stowe, he jokingly remarked that “So this is the little lady who made this big war.”

Hence, in this case, it is concluded that the correct answer is option A. "Harriet Beecher Stowe."

Learn more about Harriet Beecher Stowe here: https://brainly.com/question/1686266

Hurry....



Match the vocabulary word with its definition. Match the items in the left column to the items in the right column.


1. an announcement

pursuit

2. a person sent as a representative to a convention

delegate

3. come from

institute

4. provided with

declaration

5. bring into being; start

unalienable

6. the act of seeking

derive

7. cannot be removed or taken away

endowed

Answers

Answer:

Can you please take a picture.

Match each term in Column A with its definition in Column B.
I
Column A
Column B
1. mixed economy
a. an economic system in which economic de-
cisions are made by the government
2. incentive
b. an economic system in which people's roles
are the same as those of their parents
3. means of production c. an economic system with some free enter-
prise and some government ownership
4. economic system d. an expectation that an activity will make a
profit
5. what, how, who e. the way a group organizes itself for pro-
duction
6. traditional economic f. an economic system where decisions result
system
from buyers' and sellers' actions
7. market economic g. basic economic questions that all societies
system
must answer
8. command economic h. an economy's capital goods, which are used
system
to produce other goods and services

Answers

Answer:1.C 2.D 3.H 4.E 5.G 6.B 7.F 8.A

Explanation:

However he wants also for us to answer the other 10 questions after the mix and match before you submit.Good luck

The correct matches are 1-c,2-d,3-h ,4-e,5-g,6-b,7-f and 8-a.

What are the types of economic system?

There are 4 types of economic system i.e. traditional economic system, command economic system, market economic system and mixed system.

The correct match are as follows-:

1. Mixed economy -  An economic system with some free enterprises and some government ownership.

2. incentive - an expectation that an activity can make profit.

3.means of production - an economy's capital goods which are used tp produce other goods and services.

4. economic system- the way a group organizes its production.

5. what, how, who- basic economic questions that all societies system has.

6. traditional economy - an economic system in which people roles are same as those of their parents

7. market economic- an economic system where decisions results system.

8. command economic - an economic system in which decisions are made by government.

Learn more about economics here:

https://brainly.com/question/14787713

#SPJ2

What did the Three-Fifths Compromise do? A. It banned enslavement in three-fifths of the states. B. It split Congress into two houses, one based on population and the other giving states equal representation. C. It determined that an enslaved person would count as three-fifths of a person. D. It gave the federal government control of foreign trade.

Answers

Answer:

C

Explanation:

The 3/5th's compromise was used to calculate the amount of slaves that would be used for taxation, and it was decided that 3/5ths of the Slave Population would be used to represent the entirety for taxes.

Answer:

Proof

Explanation:

Can someone plz help me? :(

Answers

Answer:

A

Explanation:

I am almost certain its A Im sorry if you get it wrong.

PLZ HELP!!!!!
What do historians hope to achieve when they make historical arguments?
A. Refute a possible criticism of an essay's argumentative thesis
O
B. Identify any type of bias that might exist in a historical essay
C. Convince others that a particular opinion about the past is correct
D. Summarize another historian's research without formally citing it
SUBMIT

Answers

Answer:

C. I think

Explanation:

Page 1. NHD Thesis and Historical Argument. Your historical argument states the central point or focus of your project in two or three sentences. It is sometimes called a thesis or claim. Historians create historical arguments after carefully analyzing evidence from the past.

The key to good historical writing is the historical argument, presented in the form of a concise and specific thesis statement. A strong thesis statement must present an argument that is specific enough to examine credibly, provable with reliable sources, and arguable.

what type of job did most of the people in the countryside have?

Answers

Most people are Farmers

Which outcome did not occur following the Supreme Court's decision in United States v. Nixon?

Question 1 options:

President Nixon resigned.


President Nixon released the tapes.


President Nixon was impeached and removed from office.


President Nixon lost his remaining political support.

Answers

Answer: C

if you found this correct please give me brainly :)


Entraînement au développement construit en histoire. Sur une copie double correctement présentée (identité, classe, matière, sujet et date), vous réaliserez le brouillon du développement construit. Le sujet est :" dans un développement construit d'une vingtaine de lignes, à l'aide de vos connaissances, décrivez les violences subies par les civils en Europe pendant la Première Guerre Mondiale

Answers

Answer:

du développement construit. Le sujet est :" dans un développement construit d'une vingtaine de lignes, à l'aide de vos connaissances, décrivez les violences subies par les civils en Europe pendant la Première Guerre Mondiale

How much money could Mothers in Nazi Germany get?

Answers

Answer:

Bts biot in bddibyaoroegs

How did the gods and goddesses of Greece
differ from previous civilizations' gods and
goddesses?

Answers

Answer:

The ancient Greeks believed there were a great number of gods and goddesses. These gods had control over many different aspects of life on earth. In many ways they were very human. They could be kind or mean, angry or pleasant, cruel or loving. They fell in love with each other, argued with each other and even stole from each other.

King of all the gods and goddesses was Zeus. He could control the weather and was often called 'the thunderer' or 'the cloud-gatherer'. He lived with the other gods on Mount Olympus, a high mountain in northern Greece.

The ancient Greeks built great temples and sanctuaries to their gods. They held festivals in their honor, with processions, sports, sacrifices and competitions. Stories of the gods' exploits were told to children by their mothers and to large audiences by professional bards and storytellers. People today still enjoy hearing stories about the Greek gods.

Explanation:

Ancient Greeks practiced polytheism or the worship of several deities. Greeks believed that although their gods were formed in the likeness of humanity, they nevertheless possessed many human traits.

What is known about the Greek gods?

The Greeks of antiquity thought there were a lot of gods and goddesses. The various facets of existence on earth were under the sway of these gods. They resembled humans in many respects.

Zeus was the ruler of all the gods and goddesses. He was known as "the thunderer" or "the cloud-gatherer" because of his ability to influence the weather.

The Greeks of antiquity created impressive temples and sanctuaries for their gods. In their honor, they celebrated with processions, games, sacrifices, and competitions.

Mothers would tell their children tales of the deeds of the gods, while professional storytellers and bards would perform for big audiences. Even in modern times, people still like hearing myths about the Greek gods.

Learn more about Greek gods, from:

brainly.com/question/346330

#SPJ2

The map shows ancient river valley civilizations.

Map of river valley civilizations. Land near the Nile River is labeled A. Land near the Tigris and Euphrates Rivers is labeled B. Land near the Indus and Ganges Rivers is labeled C.

Letter A shows the location of which ancient river valley?

Answers

Answer:

The correct answer is C. Nile

Explanation:

First human civilizations developed in river valleys as these locations offered access to water, which was an essential resource for agriculture, raising animals and transportation. This included the Ancient Egypt civilization, which developed along the Nile River in the territory that is now Egypt in North Africa. This civilization emerged around 3100 BC and was known due to the development of a complex writing system (hieroglyphics) and its dynasties. Additionally, in the map described the location of the Nile river valley is shown by letter A because the Nile river valley covers the territory near to the Nile River, the area where the Ancient Egypt or Nile River Valley Civilization developed.

Letter A shows the location of the Nile River.

What are ancient river valley civilizations?

An economic nation or civilization located next to and deriving its food from either a river is known as a river's civilization. The zone that is in between Tigris as well as Euphrates Rivers, Mesopotamia, saw the emergence of the first river valley civilizations. This was of a great benefit at that time.

Due to easy access to water—which was necessary for agriculture, animal husbandry, and transportation—humans evolved in river valleys. Around 3100 BC saw the rise of the Ancient Egyptian civilization, which became well-known for its elaborate writing system and dynasties. Because it includes the vicinity of the Nile River, the Nile River Valley is indicated with the letter A.

Learn more about ancient river valley civilizations, here:

https://brainly.com/question/12821276

#SPJ2

The question is incomplete, the complete question is:

The map shows ancient river valley civilizations.

Land near the Nile River is labeled A.

Land near the Tigris and Euphrates Rivers is labeled B.

Land near the Indus and Ganges Rivers is labeled C.

Land near the Yellow and Yangtze Rivers is labeled D.

Letter A shows the location of which ancient river valley?

According to many historians, ONE of the main causes of the First World War
was______________: an unequal relationship, often in the form of an empire, forced on other countries and peoples, resulting in domination and subordination of economics, culture, and territory.
A) Militarism
B) Alliances
C) Nationalism
D) Imperialism

Answers

Answer: imperialism

Explanation:

PLZ HELP! The first people on the north american continent came to:

find water
trade salt
fing food
fing freedom

Answers

Answer:

i think it is find food

Explanation:

hope this helps

Answer:

freedom

Explanation:

European nations came to the Americas to increase their wealth and broaden their influence over world affairs. ... Many of the people who settled in the New World came to escape religious persecution. The Pilgrims, founders of Plymouth, Massachusetts, arrived in 1620.

How are political campaigns funded?

Answers

Under the presidential public funding program, eligible presidential candidates receive federal government funds to pay for the qualified expenses of their political campaigns in both the primary and general elections. ... Fund the major party nominees' general election campaigns (and assist eligible minor party nominees).

Hoped that helped:)

el resto de las dos jugos y el resto que queda de ustedes de acuerdo en la que me ha llegado el caso el pago por el momento en que la gente de los mismos que los de la barriga de la familia del sol en la que me lo quiero mucho mi vida y el de la empresa en la familia de la barriga y no se puede hacer algo

Explanation:

KD de naranja con el tema es una excelente oportunidad para

The Virginia and Kentucky Resolution of 1798 and 1799 claimed that the Alien and Sedition Acts violated the Constitution. It also supported the principle of states’ rights. What are states’ rights?

Answers

State rights the rights or powers retained by the regional government or a federal union under the provisions of a federal constitution!

Hope this helps! Fingers crossed let me know if this is not what you are looking for and I will try and ask my history teacher!


1. What does the word clue mean?
A. antonym B. hint
C. neglect D. synonym
tras
to his custo with a movie and everyone cheer



Answers

Answer:

b

Explanation:

clue is mainly used as a guiding point or idea to help solve a case for example. A hint also acts in the same way.

Answer:

B. Hint

Explanation:

a form of giving someone a little help without giving away the answer.

Other Questions
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. who were dev and ashamvav At a hospital, 56 percent of the babies born are not girls. Of the baby girls born, 12 percent are premature. What is the probability of a premature baby girl being born at this hospital? round to the nearest percent. Why did Marshall describe the economy in Europe over the past 10 years as "highlyabnormal"? which organelle modifies sorts and packages proteins I need some essay ideas for: "Describe the biggest challenge youve faced and overcome as a student OR Describe a time when you failed and persevered through the situation?"What can I write about? DNA contains all the traits that we inherit from our parents.True or false Pls explain how to solve it! (Will mark brainylist)