What type of government do Mexico and Brazil have?

Answers

Answer 1

Answer:

The Politics of Mexico take place in a framework of a federal presidential representative democratic republic whose government is based on a congressional system, whereby the President of Mexico is both head of state and head of government, and of a multi-party system.

Explanation:

Answer 2

Answer:

federal government

Explanation:

they have the same government as everyone


Related Questions

Which group did the Ottoman Empire conquer first?

the Byzantines
the Greeks
the Mesopotamians
the Turks

Answers

Answer: The Turks.

Explanation:

Loans given in exchange for governmental and economic reforms are called
A structural adjustment loans
B. International Monetary Fund loans
C. World Bank loans
D. debt repayment loans

Answers

Answer:

It is C

Explanation:

Answer:  A. structural adjustment loans

Explanation: hope this helps!!

Life in the Middle Colonies:

Respond to each question in three to six complete sentences. (100 POINTS)

1. What was the Columbian Exchange? How did it affect the middle colonies?

2. Briefly describe the New York City slave rebellion of 1712. What events took place? What happened as a result of the rebellion?

3. What was William Penn’s “holy experiment”? Describe two of its characteristics.

Answers

Answer:

The Columbian exchange, also known as the Columbian interchange, named after Christopher Columbus, was the widespread transfer of plants, animals, culture, human populations, technology, diseases, and ideas between the Americas, West Africa, and the Old World in the 15th and 16th centuries.

Explanation:

Several plants native to the Americas have spread around the world, including potato, maize, tomato, and tobacco. Before 1500, potatoes were not grown outside of South America. By the 19th century they were consumed widely in Europe and had become important crops in India and North America. Potatoes eventually became an important staple of the diet in much of Europe, contributing to an estimated 25% of the population growth in Afro-Eurasia between 1700 and 1900. Many European rulers, including Frederick the Great of Prussia and Catherine the Great of Russia, encouraged the cultivation of the potato

Answer #2

The New York Slave Revolt of 1712 was an uprising in New York City, in the Province of New York, of 23 enslaved Africans.

Explanation:

In the early 18th century, New York City had one of the largest slave populations of any of England's colonies. Slavery in the city differed from some of the other colonies because there were no large plantations. Slaves worked as domestic servants, artisans, dock workers, and various skilled laborers. Enslaved Africans lived near each other, making communication easy. They also often worked among free black people, a situation that did not exist on most Southern plantations. Slaves in the city could communicate and plan a conspiracy more easily than among those on plantations.

Events that presumably led to the revolt include a decrease in freedom and status when the English took over the colony in 1664. Under Dutch rule, when the city was part of New Netherland, freed slaves had certain legal rights, such as the rights to own land and to marry. After the English took over New Amsterdam and made it the colony of New York, they enacted laws that restricted the lives of enslaved peoples.

By the early 1700s, about 20 percent of the population were enslaved black people. The colonial government restricted this group through several measures: requiring slaves to carry a pass if traveling more than a mile (1.6 km) from home; discouraging marriage among them; prohibiting gatherings in groups of more than three persons; and requiring them to sit in separate galleries at church services.

A group of more than twenty black slaves gathered on the night of April 6, 1712, and set fire to a building on Maiden Lane near Broadway. While the white colonists tried to put out the fire, the enslaved blacks, armed with guns, hatchets, and swords, attacked the whites then ran off. Almost immediately all runaway slaves were reunited with their owners.

what are the advantage of having military power split between two branches?

Answers

Answer:

the executive branch checks the power of the military

Explanation:

Name 10 of The Greatest German Leaders of Your Opinion!!!
1
2
3
4
5
6
7
8
9
10

Answers

Answer:

Ludwig van Beethoven (1770-1827) ...

Otto von Bismarck (1815 – 1898) ...

Friedrich Nietzsche (1844-1900) ...

Hugo Junkers (1859 – 1935) ...

Max Ernst (1891 – 1976) ...

Werner Herzog (1942 – ) ...

Hansi Kursch (1966 – ) ...

Steffi Graf (1969 – )

Claudia Schiffer (1970 – )

Diane Kruger (1976 – )

Explanation:

Why is the issue of ’whether monuments of confederates and slave owners should be taken down or not’ so controversial?

Please help!

Answers

Answer: Because that was when they had African Americans work like slaves and they do not deserve to have their monument for owning and sometimes beating African Americans

Explanation:

4 parts that make up the decleration?

Answers

There are four parts to the Declaration of Independence which include the Preamble, A Declaration of Rights, A Bill of Indictment, and A Statement of Independence.

Answer: the Preamble, national rights, list of greivences, and the resolution

Explanation: The PreambleThe Preamble, tells why the Declaration of Independence was written, and explains why they must form a new nation.

The Declaration of National Rights

The Declaration of National Rights, the longest part of the letter states the equality of men and the famous ;" Life, Liberty and Pursuit of Happiness." The Life part means the people have a right to criticize the government and the Pursuit of Happiness means they have the right to own property and defend it.  

List Of Grievances

The list of Grievances state the abuses King George 111 took upon the colonists such as the laws he made the colonists follow. It also states the other unjust things the King did to them .

The Resolution

The Resolution wraps up the whole Declaration, asking the King to correct  the laws and at the end of the letter it states their independence from Britain.  

What prompted the outbreak of the second intifada?
A.Anwar Sadat's assassination
B.peace talks between Abbas and the Israelis
C.Ariel Sharon's visit to the Temple Mount in Jerusalem
D.Hamas's majority win in the Palestinian parliamentary election

Answers

Answer:

It is C.

Explanation:

The outbreak of the second intifada, also known as the Al-Aqsa Intifada, was primarily prompted by, Ariel Sharon's visit to the Temple Mount in Jerusalem.

The option (C) is correct.

In September 2000, then-Israeli opposition leader Ariel Sharon, accompanied by a large security detail, visited the Temple Mount, a site considered holy by both Muslims and Jews. The visit was seen by Palestinians as a provocative act and a violation of their rights.

This event ignited widespread protests and demonstrations by Palestinians, leading to a violent uprising against Israeli occupation. While factors like the peace talks and Hamas's election win had subsequent effects, Sharon's visit is widely considered the immediate catalyst for the second intifada.

Learn more about second intifada:

https://brainly.com/question/20358377

#SPJ2

Which of the following are the most common offenses that may be eligible for capital punishment?
A. murder, kidnapping, and treason
B. larceny, robbery, and arson
C. arson, murder, and fraud
D. burglary, kidnapping, and motor vehicle theft ​

Answers

Answer: A

Explanation:

Murder, kidnapping, and treason

The answer choice which is the most common offenses that may be eligible for capital punishment include:

A. murder, kidnapping, and treason

According to the given question, we are asked to state the answer choice which is the most common offenses that may be eligible for capital punishment

As a result of this, we can see that capital punishment has to do with violent crimes mostly and usually goes with either life imprisonment, death sentence or very long jail terms if the accused is found to be guilty. Examples of these are murder, kidnapping and treason.

Therefore, the correct answer is option A

Read more about capital punishment here:

https://brainly.com/question/12457698

Use the quote to answer the question that follows. "(We will provide) a safe, secure and high quality system of free public schools… (We will also provide for) the operation of (colleges) and other public education programs." This quote is most likely from which document? The Florida Constitution The Declaration of Independence The Bill of Rights The U.S. Constitution

Answers

Answer:

Explanation:

The quote is  from The Florida Constitution

PLZ MARK AS BRAINLIEST

Answer:

the answer is The Florida Constitution

Explanation:

I took the test

TRUE OR FALSE? The Antebellum South known for manufacturing, big cities, and immigration

Answers

Answer: True

Explanation:

Which statements are true? Choose all answers that are correct. Senators and members of the House of Representatives must agree to serve at least two terms in office. Senators have to have been a U.S. citizen for nine years prior to being elected; members of the House of Representatives must be American citizens for seven years before being elected. Senators must be at least 30 years old; members of the House of Representatives must be at least 25. Senators and members of the House of Representatives must live in the state they represent.

Answers

Hey, sorry I didn’t know the awnser

The term "Chicano" as Lalo Delgado
defines it relates to Mexican Americans
and their fight for
a. Civil rights
b. Free schools
c. Cultural Preservation
d. a and c

Answers

Answer:

c

Explanation:

which is a direct strategy for influencing government

Answers

Answer:

forming a coalition to hire a lobbyist

Explanation:

In your opinion, do you see peace happening between the two sides * Israel and Palestine ?

Answers

Answer:

NOPE

Explanation:

to be honest there's never peace between those country's maybe in the world right now at this time because you don't hear that many reports about those country's because of all the politics going on.

Answer:

What is Israel?

Explanation:

I only know Palestine tbh. Palestine needs to have peace.

Who was the leader of the German puppet state set up in France after the fall of Paris?

A. Charles de Gaulle
B. Doris Miller
C. Philippe Petain
D. Dwight Eisenhower

Answers

Answer:

Philippe Pétain

Explanation:

This miscalculation threw French and British troops into a hurried and unorganized retreat. Eventually, the German advance forced them to retreat to a few seaports, and this maneuver forced the Allies to evacuate to Britain. Paris then fell on June 14, 1940. On June 22, 1940, French officials signed an armistice with German representatives. Over the course of six weeks, France had fallen. German officials set up a puppet government in France, known as the Vichy Government, and placed Philippe Pétain in charge. This puppet state controlled northern France. In southern France, Charles de Gaulle and his Free France Forces sought to undermine France's German occupation.

Answer:

C. Philippe Petain

Explanation:

Which of the following contributed most to the situation described in this
excerpt?-
А
The influx of immigrants into urban areas
B
The rise of corporate monopolies
Strict banking regulations and high income tax rates
D
High unemployment and widespread home foreclosures

Answers

Answer: High unemployment and widespread home foreclosures

Explanation: I took the test on usatestprep

High unemployment and widespread home foreclosures are contributed most to the situation described in this excerpt. Hnece, option D is correct.

What is meant by High unemployment?

A high unemployment rate suggests that the economy is not producing enough jobs to satisfy demand from jobseekers.

Low quality housing, less recreational activities, limited access to public services and transportation, and underfunded schools are more prevalent in areas with high unemployment rates.

The effects of unemployment include decreased business earnings, budget cuts, and staff reductions as well as decreased demand, consumption, and purchasing power. Without some sort of intervention, a difficult to escape vicious cycle is set in motion.

Thus, option D is correct.

For more details about High unemployment, click here:

https://brainly.com/question/15835797

#SPJ6

Which of these grievances is included in the Declaration of Independence?

Britain controls who the colonies can trade with.
Britain tells the colonies how to build their homes.
King George III has never visited the colonies.
King George III should wear a silver crown.

Answers

Answer: A) Britain controls who the colonies can trade with.

Explanation: Grievances in the Declaration of Independence

The grievances/complaints was a section from the Declaration of Independence where the colonists listed their problems with the British government, specifically George III. The United States Declaration of Independence contains 27 grievances against the decisions and actions of George III of Great Britain.

Brainliest?

Statement that explains grievances that  was included in the Declaration of Independence is A: Britain controls who the colonies can trade with.

In the Declaration of Independence, there was a list by colonist about their problems with the British government, this section is regarded as Grievance.

And the United States Declaration of Independence posses some number of grievance, one of the 27 grievance is where it was stated that Britain controls who the colonies can trade with.

Therefore, option A is correct.

Learn more at:

https://brainly.com/question/11612375?referrer=searchResults

In Colombia, the plains and coastal lowlands are ______.
moderate
hot
warm
cold
ASAP

Answers

Answer:

Moderate

Explanation:

Answer:

moderate

Explanation:

Why were the farmers drawn to cities in the northeast and Midwest

Answers

Answer:Immigrants were drawn to cities in the Northeast and Midwest because of the new opportunities for work. ... Farmers were drawn to the cities in an effort to find whatever work they could. Due to rapid improvements in farming technology and inventions work was scarce for farmers.

Explanation:Hope this helps you out love <3

The reason why farmers went to cities in the nation's northeast and Midwest was to find jobs in industries and factories.

Why did farmers move to the Northeast and Midwest?

Towards the end of the 1800s, economic improvements in industries had led to a rise in job opportunities in the Northeast and Midwest.

As a result, farmers flocked to those areas in huge numbers in order to make profits from the wages that companies paid.

Find out more on farmer in the 1800s at https://brainly.com/question/6110310.

#SPJ2

What was the importance of the Harlem Hellfighters regimental band?

Select the best answer from the choices provided.
A.
It was composed of the bravest soldiers in the unit.
B.
It helped make jazz music popular in France.
C.
All of its members won the Medal of Honor.
D.
The band was disbanded by racist superior officers.

Answers

Answer:

d

Explanation:

Help me plsssss I need help

Answers

Answer:

The answer should be C

Explanation:

In the imagine you clearly see that theres a man on the floor, instead of standing up high just like the other man, therefore the man with a crown standing is being given respect which has to be because he plays an important role

What are the 3 Major accomplishments of Egypt

Answers

Answer:

The many achievements of the ancient Egyptians include the quarrying, surveying and construction techniques that supported the building of monumental pyramids, temples, and obelisks; a system of mathematics, a practical and effective system of medicine, irrigation systems and agricultural production techniques

Explanation:

The many achievements of the ancient Egyptians include the quarrying, surveying and construction techniques that supported the building of monumental pyramids, temples, and obelisks; a system of mathematics, a practical and effective system of medicine, irrigation systems and agricultural production techniques

the most important Ancient Egyptian inventions.
Bowling. ...
Paper And Ink. ...
Make-Up And Wigs. ...
Barbers. ...
The Calendar And Timekeeping. ...
Tables (And Other Furniture) ...
Toothpaste And Breath Mints. ...
The Police.

Who became king of England after the Battle of Hastings?

Answers

William became king after the battle of hastings

What is one DEMOCRATIC STATE that committed mass violence among its people in the 19th-20th century?
WILL GIVE BRAINLY

Answers

California would be a good answer

In March of 1836, delegates met at Washington-on-the-Brazos intending to —
A design the “Come and Take It” flag
B create a plan to defend the Alamo
C establish an independent government
D negotiate a peace settlement with Mexico

Answers

Answer:

Option: C. establish an independent government.

Explanation:

Delegates met at Washington on the Brazos in 1836 to announce Texas independence from Mexico and to draft the constitution of the Republic of Texas. 59 delegates were meet to attend the Convention of 1836.

The Convention of 1836 named Sam Houston the head of the military forces.  

The Monroe Doctrine declared that the United States would

Answers

Answer: that the United States would not tolerate further colonization or puppet monarchs

Explanation:

Answer:

The Monroe Doctrine was the declaration by President James Monroe, in December 1823, that the United States would not tolerate a European nation colonizing an independent nation in North or South America. The United States warned it would consider any such intervention in the Western Hemisphere to be a hostile act.

Explanation:

hope that helps brainly plz

How does the idea of a "white man's burden" connect to America's treatment of Native Americans?

Answers

Answer:

The Native Americans were pushed out of their own land, killed, and beaten by "the white man". This is the sole reason why the native American population is "the white mans burden" as Native Americans find it hard to live on scraps left over by the US government to justify their colonialism.

Explanation:

How did the Japanese forces defeat the invading mongols in the 13th century

Answers

Answer:

Which of the following contributed most to Japan's defeat of the invading Mongols in the 13th century? An army of samurais joined forces to fight the Mongols. Japanese samurais joined forces with Korean warriors to fight the Mongols. Typhoons forced the Mongols to retreat and then destroyed their ships.

Explanation:

they joined forces with korean warriors.

Answer:

Japenese join forces with the Korean warriors and killed all the mongols.

Explanation:

Political Parties & Media Bias



True or False: The democratic party is known for its conservative ideas, such as: small government, cutting taxes for the rich, and increased military spending. *
1 point
True
False
True or False: Republicans are most likely to oppose gay marriage, abortion, and illegal immigration. *
1 point
True
False
True or False: Disinformation happens when news outlets report mistakenly inaccurate information. *
1 point
True
False
True or False: The media uses propaganda to manipulate the thinking and beliefs of viewers. *
1 point
True
False
True or False: Most of the mainstream media shows bias toward the democratic party. *
1 point
True
False
True or False: A democrat is most likely to support raising taxes on the rich, larger government, and restrictions on gun rights. *
1 point
True
False
True or False: Disinformation is deliberately fake news designed to mislead the public. *
1 point
True
False
True or False: The US political system is a known as a two-party system, because the democratic and republican parties hold all the power, money, and influence. *
1 point
True
False
True or False: Due to the electoral college system, it is not possible for a third party candidate to become the President of the United States. *
1 point
True
False
True or False: A person's political beliefs form through their experience, background, and values. *

True
False

Answers

Answer:

I hope this is right! I'm so sorry if it's not accurate im doing a lot of things right now ~_~

Explanation:

1. False

2. True

3. False

4. True

5. I have no idea but im going with false

6. True

7. True

8. True

9. I think this is False

10. True

Other Questions
Connections Academy Geometry10A semester exam. Does anyone have the answers im 1% away from passing. d)Rajendra is visiting to his uncle. (simple present tense) 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, The scale on a map says that 4 cm represents 5 km. What distance on the map (in centimeters) represents an actual distance of 4 km? A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot Anyone know the answer to this? There are 32 Drama DVD's. The ratio of Drama DVD's to Mystery DVD's is8:5. How many Mystery DVD's are there? what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a 2- some of your mates like Chinese cousin, don't they?Why we use some of at the first of the sentence!! Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A?