Answer:
The primary function of the plasma membrane is to protect the cell from its surroundings. Composed of a phospholipid bilayer with embedded proteins, the plasma membrane is selectively permeable to ions and organic molecules and regulates the movement of substances in and out of cells.
Explanation:
Answer:
The primary function of the plasma membrane is to protect the cell from its surroundings. Composed of a phospholipid bilayer with embedded proteins, the plasma membrane is selectively permeable to ions and organic molecules and regulates the movement of substances in and out of cells.
Explanation:
Helpp mee please and thankss!!
Hope it helps
Answer:
B. Solar Radiation
Explanation:
In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?
Answer:
Iodine
Explanation:
Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.
If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.
Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis
Answer:
Answer D
Explanation:
just took the test.
Its easy! If right will give brainlist! Don't overthink..:) Just answer
The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks
Answer:
When the mirror is inside the focal point..?
Which of the following processes begins when a star enters the main sequence?
a
Nuclear fission
b
Nuclear fusion
c
Condensation of a nebula
d
Appearance of a supernova
Answer:
i believe it is B: Nuclear Fusion
Explanation:
Answer:
C. Nuclear Fusion
Explanation:
I am 1000000000% sure this is correctamundo, stay cool, and have a great day!
Name two cell structures plant cells have that animals do not have and one structure that looks very different in a plant and animal cell (think size).
Answer:
Plant cells have a cell wall and chloroplasts and the cell wall gives the cell a rectangular shape unlike animal cells which have a round shape because we only have a cell membrane.
Answer:
plant cells have a cell wall . animals do not have and one structure that looks very different in a plant and animal cell
Explanation:
Plant cells are classified as
pluripotent
omnipotent
multipotent
totipotent
Answer:
pluripotent i think sorry if I'm wrong
compare the chemical equations for photosynthesis and cellular respiration explain how the two processes are interrelated
Answer: Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water
Explanation:
Bone is not a solid matter.
OA
True
O B. False
Answer:
FALSE
Explanation:
commen sense
Most abundant element in the biomolecules studied (fats, proteins, carbohydrates, nucleic acids) was....
carbon
Monosaccharide
Amino acid
amino
acid
Explanation:
thats amino acid
People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis
Answer:
C. have medical insurance
Explanation:
People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.
The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.
What is the diagnosis?The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.
Thus it is well explained.
To learn more about the medical insurance refer to link :
https://brainly.com/question/1941778
Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual
Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.
What are genes?
Genes are composed of DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.
The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.
Genes code for the traits such as the color of eyes, height quality of hair, and more.
Learn more about genes, here:
https://brainly.com/question/31121266
#SPJ2
All cells divide and reproduce the same way ... true or false explanation needed
Answer:
False
Explanation:
False because cells can reproduce in two ways. Mitosis, the process of making new body cells or cell division. OR Meiosis where there is genetic information transfered between cells such as how humans are made.
All cells do not divide and reproduce the same way since there are two methods for cells to divide. So, the given statement is False.
What is Cell division?The process by which a parent cell divides into two daughter cells is known as cell division. Cell growth and chromosome replication precede cell division, which often happens as part of a longer cell cycle. Usually, cell division happens as part of a longer cell cycle where the DNA is reproduced as the cell nucleus divides during cell division.
Meiosis and mitosis are the two processes through which cells can reproduce. The process of creating new body cells, or mitosis, differs from meiosis, which is the process by which genetic material is passed between cells, as in the creation of humans. Thus, not all cells divide and reproduce in the same way.
Therefore, the given statement is False.
Learn more about Cell division, here:
https://brainly.com/question/29773280
#SPJ2
What is a society that is able to survive and function over a specified time?
Answer:because time and society are different
Explanation:
Which of the following problems are environmental indicators of acid deposition?
Decreased pH levels in lakes and rivers
Decreased concentration of aluminum in the soil
Changes in development of indicator organisms of an ecosystem
II only
III only
I and III
I and II
Answer:
I and III
Explanation:
Acid deposition will decrease pH levels in lakes and rivers since it contaminates them and lowers their pH, and organisms may be affected by the increased acidity in their immediate surroundings, but aluminum has nothing to do with pH levels at all.
Hope thish elped!
Option I and III shows the problems of environmental indicators of acid deposition.
The following information should be considered:
The acid deposition should reduce the level of pH in terms of lakes and rivers as it contaminates also the organisms should impact when the acidity should be increased for the surroundings. But the aluminum does not have any relationship with pH levels.Therefore we can conclude that options I and III are correct.
Learn more: brainly.com/question/13107711
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain
Answer:
October
Explanation:
October is one of the hurricane season months
Small aquatic organisms, such as coral, are the producers of the ocean.
Please select the best answer from the choices provided true or false
Answer:
true
Explanation:
on edg
Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.
What is aquatic organism?The term aquatic organism has been defined as the the organism lives in the water is known as the aquatic organism. The corals are essential part of the marine ecosystems. They are feeding upon zooplankton, but also their polyps get sugar that is produced by the algae living on them. Also, the corals provide much needed shelter for lots of marine animals, but also are on the menu of some, like the starfish for example.
Limestone is in form of sedimentary rock that is made up of skeletal fragments of marine organisms such as forams, corals and molluscs. However, limestone is formed from the shell of an organisms because the shell is made up of calcite or aragonite.
Due to the presence of nutrients that swipe from ocean to the shores along with tides which makes predators to be present along the shores which ultimately pose a threat to coastal aquatic organisms.
Therefore, Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.
Learn more about aquatic organisms on:
https://brainly.com/question/1397242
#SPJ6
has anyone done this worksheet? i need help with it. thanks:)
explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.
Explanation:
During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.
Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.
Which statement best describes homeostasis in a cell?
A. Molecules are in equilibrium (balance) inside and outside the cell
B. Active transport causes molecules to move from low to high concentration the molecules are un-equal
C. Pathogens enter cells and infect those cells, causing them to malfunction
D. Cells do not maintain homeostasis with their external environments.
Answer:
I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.
Explanation:
Is the troposphere high or low and what is the temperature there only answer if you know it
Answer: High
Explanation:
The average temperature of the troposphere is 62°F (17°C), Pls give thanks because I got hack
Which of the following is not a technological way of improving air quality?
a.
using electrostatic precipitators
b.
installing solar panels
c.
composting
d.
building wind turbines
Answer:
c.
composting
Explanation:
Composting is not a technological way of improving air quality (Option C).
What is air quality?Air quality refers to the absence of pollutant substances (e.g. monoxide carbon) in the air.
Air quality is fundamental for maintaining overall health and increasing the quality of life.Air quality can be measured by using different devices or indicators (for example, by measuring the amount of carbon monoxide and nitrogen oxides).In conclusion, composting is not a technological way of improving air quality (Option C).
Learn more about air quality here:
https://brainly.com/question/1211889
what is an example of primary ecological succession?
a. plants and animals invading an abandoned crop field
b. lichen growth on rocks
c. minerals spurring rapid plant growth
d. mangroves stabilizing the soils on tropical coasts
Answer:
mangroves stabilizing the soils on tropical coasts.
What is the electrical charge of the nucleus of an atom that has 11 protons , 12 neutrons , and 11 electrons ?
Answer:
The 11 positive protons cancel out the 11 negative electrons, and the overall charge of the atom is zero. So it neutral
Explanation:
I hope this helps!!
The nucleus of an atom has only protons and neutrons. Since the neutrons are neutral, the charge on the nucleus, in this case, would be +11.
What is the atomic charge?The difference between the number of electrons and protons in an atom is defined as the charge on that particular atom. An atom has three sub-atomic components. These are electrons, protons and neutrons.
The electrons are negatively charged, the protons are positively charged and the neutrons are neutral.
Because the neutrons are neutral, the increase or decrease in the number of electrons or protons affects the charge on an atom. If the number of protons is higher, the atom will be positively charged. If the number of electrons is higher, the atom will be negatively charged.
The protons and neutrons are present in the nucleus of an atom and the electrons are present in atomic shells.
Therefore, in a nucleus with 11 protons, and 12 neutrons, the charge will be +11
Read more about atomic charge, here https://brainly.com/question/5308494
#SPJ6
Question: Why do you deserve this scholarship? ...
Question: What are your career goals? ...
Question: Tell me about a mistake you made. ...
Question: Why did you choose this school? ...
Question: What activities are you involved in? ...
Question: Tell me about a personal achievement that makes you proud
Answer:
I deserve this scholarship because I work hard. I feel me getting this scholarship is my dedication paying off. My career goals are to be an orthopedic surgeon, so I can give back to my community, and help others. This has been my dream for a while. I chose this school because I feel it will help me better myself along the Journey of learning. I am involved in football, I was in the National Junior Honor Society in middle school, and I did some basketball. A personal achievement that makes me proud are all of the certificates on my walls of good grades and character badges.
A scholarship is a form of financial support for students for further education. Scholarships are awarded based on various criteria such as academic merit, diversity and inclusion, athletic ability, and financial need.
• The award criteria typically reflect the values and goals of the founder or sponsor of the award.
• While grant recipients are not required to repay grants, the grants may require that the recipient continue to meet certain requirements throughout their support period, such as maintaining a minimum GPA or participating in a specific activity (e.g. recipient or as a teaching assistant for some graduate fellowships).
• Scholarships may include a cash award, a non-cash award (such as a tuition or dormitory fee waiver), or a combination there of.
What is the purpose of scholarship for students?
Scholarships are designed to reward a student's academic achievement and educational programs.Whether you are starting your career or studying in high school to acquire new skills, receiving a scholarship is a great accomplishment.Learn more about scholarship here.
http://brainly.com/question/904448
#SPJ2
To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden
Answer:
To preserve vegetation and soil fertility of land
Explanation:
.
A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.
What is nucleotide?It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.
These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder. The type of sugar that is used in a DNA helix is called deoxyribose.
Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.
Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.
Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.
Learn more about white blood cells on:
https://brainly.com/question/19202269
#SPJ5
what are the inputs and outputs of the reaction
Answer:
The inputs are carbon dioxide from the air and the ATP and NADPH produced by the light reactions. The cycle's output is an energy-rich sugar molecule. The Calvin cycle uses carbon from the carbon dioxide, energy from the ATP, and high-energy electrons and hydrogen ions from the NADPH.
Explanation:
The light reactions, which occur during photosynthesis, have specific inputs and outputs. The inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.
Light energy is absorbed by the chlorophyll pigments in the thylakoid membranes, while water molecules serve as a source of electrons for the photosynthetic electron transport chain.
ATP is a high-energy molecule that serves as the primary energy source for cellular processes. NADPH is a coenzyme that carries energized electrons and plays a role in the synthesis of carbohydrates during the subsequent dark reactions of photosynthesis. Molecular oxygen is a byproduct of light reactions and is released into the atmosphere as a waste product. Together, these outputs provide the energy and reduce the power needed for the synthesis of organic molecules during photosynthesis.
Therefore, the inputs of the light reactions include light energy and water. The outputs of the light reactions are ATP (adenosine triphosphate), NADPH (nicotinamide adenine dinucleotide phosphate), and molecular oxygen.
For more details regarding light reactions, visit:
https://brainly.com/question/13349357
#SPJ6
Which of the following statements regarding prokaryotic and eukaryotic cells is true
Answer:
I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells
Answer:
They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.
Hope this helps, have a great day/night, and stay safe!
Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water