What is the value of the expression (-12) (-5) +4 divided by (-2)?

Answers

Answer 1
-32
-12(-5) is 60
60+4 is 64
64/(-2) is -32 because two different signs is negative and the same sign is positive
Hope this helps
Answer 2
The answer is -32!!!!!!!!

Related Questions

this is a question for someone SPECIFIC
(9x8) + 4(3x7) =

Answers

Answer:

156

Step-by-step explanation:

9x8=72

3x7=21

21x4=84

72+84=156

Help Help Help Help...What does it take for an orbiting spacecraft to escape its orbit?

Answers

Answer:

Manual Override??

Step-by-step explanation: I'm prop wrong

Answer:

To leave its orbit, the spacecraft must go very fast to break free of gravity.

Step-by-step explanation:

Which quotient matches the description of solving with partial quotients for 240÷15 ? Step 1: Subtract (10×15) from 240 to get 90. Step 2: Subtract (6×15) from 90 to get 0. Step 3: Add the partial quotients.





help meh ples

Answers

3509 is tie correct awnser

Answer:

3509 is tie correct awnser

Step-by-step explanation:

find the difference PLSSSSSSSSSSSSSSSSSSSSSSSSS

Answers

Answer:

-1 5/9

Step-by-step explanation:

so first, simplify the signs so they don’t confuse you,

-5/6 - 17/18 + 2/9 (Since there are two negatives near the end, and their tecxhnically being mulitplied, -2/9*-1 (I added 1 for place holder) and when you multiply a negatives by a negative, you get a positive.

So find the lcm of the denominators which is 18 in this case

-15/18 - 17/18 + 4/18

Now solve the problem from left to right

you’ll get -1 5/9 if you simplified

-1 5/9 that’s he difference xx welcome

help me again. i need help. thx 4 helping

Answers

Answer:

16 square units

Step-by-step explanation:

The formula for the area of a right triangle is ab/2 (a and b both being legs).

First, we find the legs' length which is MK and JK.

Since both points J and K are on the same y level, we look at the X coordinates and see how far apart they are.

Since both points M and K are on the same x level, we look at the Y coordinate.

M is 4 points away from K, so the leg MK is 4 units long.

J is 8 points away from K, so the leg JK is 8 units long.

Plug this into the formula and we get

[tex]\frac{4*8}{2}[/tex]

[tex]\frac{32}{2} = 16[/tex]

A runner charted how long it took for her to run a certain distances here is the information she gathered
how many minutes will it take her to run 5 miles

Answers

:8 x 5

cause its counting by eights so if u multiply what its counting by and how many miles you will get your hope this helps  

Answer:

40 minutes

Step-by-step explanation:

If each mile takes her 8 minutes long then 5 miles will be 5×8= 40

Solve these questions. Pls show your work.

Answers

I solved it but don’t know how to show my work

Answer:

I cant see the pic owo

Step-by-step explanation:

The surf shop orders 8 life vests for every 6 goggles .if 39 pairs of goggles are ordered, how many life jackets should be ordered.

Answers

39/6 = 6.5
6.5 x 8 = 52
The answer is 52

Answer:

104

Step-by-step explanation:

HELP ILL GIVE BRAINLIEST I NEED IT ASAP
I NEED THESE 2 QUESTIONS

Answers

Y=3+4x
I can’t see the second one but this is the answer to number 7

Answer:

7. Y=3+4x

I cant see #8 sorry.

hope this help have a good day

Simplify: x2 + 5x + 6(x + 3) x 42x + 4
4
2
2(x + 2)
(x + 2)

Answers

252x squared + 763x + 4
252xsquared + 763x +4

hehe please help with this question

Answers

Answer:

it is the first option choice -$24.00

Step-by-step explanation:

write an expression that is equal to -15.66 divided by 5.8 and the fine the quotient

Answers

Answer:

16

Step-by-step explanation:

16 is the right answer

You have 18 stamps from Mexico in your stamp collection. These stamps represent 38 of your collection. The rest of the stamps are from the United States. How many stamps are from the United States?

Answers

It’s 20, 38-18=20 so yea:)

Amanda creates jewelry for a living. For smaller pieces, Amanda spends $0.85 on supplies, and for larger pieces she spends $1.74 on supplies. If Amanda sells 23 small pieces of jewelry for $8.50 each and 19 large pieces of jewelry for $18.50 each, what is her total profit?

Answers

$25.61 BIG BRAIN GAME

Answer:

$18.50 Because if you have $18.50 and you divide it by 19 you will get $18.50. Hope that helps a bit.

Step-by-step explanation:

A block of clay contains twenty 4 - ounce portions of clay. Ceramics teacher wants to use the block to make as many spheres of clay as possible. Each weighing ⅖ pound. How Many spheres can the class make

Answers

Answer:

12.5

Step-by-step explanation:

20 x 4 = 80

80 ÷ 16 = 5

5 ÷ 2/5 = 12.5

Using 24 ounce portions of clay, maximum they can make 3 spheres.

Given that, a block of clay contains 24 ounce portions of clay.

What is metric conversion?

Metric Conversion refers to the conversion of the given units to desired units for any quantity to be measured.

We know that, 1 pound = 16 ounces

So, 1 ounce = 1/16 pound

Then 24 ounce = 24/16

= 1.5 pound

Here, each sphere of clay weighing 2/5 = 0.4 pounds

Number of spheres = 1.5/0.4

= 3.75

Maximum 3 spheres

Therefore, using 24 ounce portions of clay, maximum they can make 3 spheres.

To learn more about the metric conversion visit:

brainly.com/question/21244256.

#SPJ2

3x/2 - x = x/10 - 6/5

Answers

Answer:  -3

X  =  -3        

Step-by-step explanation:

Multiply the numbers i hope this helps god bless

Answer:

= -3

consider marking me brainiest

Step-by-step explanation:

What was the first error that Andrea made?
O Andrea used the reciprocal of the slope.
Andrea made a computational error when she simplified m.
Andrea substituted incorrectly when she solved for b.
Andrea made a sign error when she solved for b.

Answers

It’s Y-61=6712 • (x-48)

Answer:

B.

Step-by-step explanation:

A cylinder with a height of 24 centimeters has a volume of 2,713 cubic centimeters.
Which is closest to the radius of the cylinder?

Answers

Answer:

I think you got it right

Step-by-step explanation:

The closest to the radius of the cylinder that has a volume of 2,713 cubic cm is: B. 6 cm.

What is the Volume of a Cylinder?

Volume = πr²h

Given the following?

Radius (r) = ?

Height (h) = 24 cm

Volume of the cylinder = 2,713 cubic centimeters

2,713 = π(r²)(24)

2713/24π = r²

40 = r²

r = √40

r = 6.3 cm

The closest is: B. 6 cm.

Learn more about volume of a cylinder on:

https://brainly.com/question/9554871

#SPJ2

if you reflect any shape across the x-axis and then rotate it 180 degrees about the origin, do you get the same result that you would if you reflect it across the y-axis and then rotate it 180 degress about the orgin? what does that mean?

Answers

Answer: No the finished shapes would be in different quadrants

Step-by-step explanation:

The table shows the linear relationship between the number of hours Francis worked, x , and the amount of money Francis earned, y.







Based on the table, how much did Francis earn per hour?

Answers

he earned 14$ and hour, because when you divide 17.5 divided by 1.25 you get 14

Answer:

your awnser would be 14.00$ aan hour

i hope i helped u

Step-by-step explanation:

A farmer says that for every row of tomato seeds he plants, he can harvest 6.5 bushels of tomatoes. The farmer needs to harvest at least 52 bushels of tomatoes. What is the least number of rows of tomato seeds that the farmer will need to plant?

Answers

Answer:

8 rows

Step-by-step explanation:

The answer is 8 because 52 divided by 6.5 is 8

The least number of rows of tomato seeds that the farmer needs to plant is 8 row.

Given that, a farmer says that for every row of tomato seeds he plants, he can harvest 6.5 bushels of tomatoes.

What is the unitary method?

The unitary method is a technique for solving a problem by first finding the value of a single unit, and then finding the necessary value by multiplying the single unit value.

The farmer needs to harvest at least 52 bushels of tomatoes.

The number of rows of tomato seeds need to plant = 52/6.5

= 8

Therefore, the least number of rows of tomato seeds that the farmer needs to plant is 8 row.

To learn more about the unitary method visit:

brainly.com/question/22056199.

#SPJ2

-3(x-4) + 3(a-6) ————-

Answers

Answer:

3x + 3a - 6

Step-by-step explanation:

Answer:

-3x + 3a - 6

Step-by-step explanation:

-3 (x - 4) + 3 (a - 6)

Apply distributive property

-3x + 12 + 3a - 18

Add the terms

-3x + 3a - 6

I hope this helps!

What is a scatter plot?

A.A table of measurement data used to construct a graph
B.A display of points that shows the relationship between two sets of data
C.A graph that has several different lines scattered on a coordinate plane
D.A graph that is nonlinear

Answers

I believe B hope this helps

Answer:

b

Step-by-step explanation:

its a graph usually to tipically display two variables for a set of data with points

There are 3 students to 1 adult on a field trip. You need to find the number of adults needed for 24 students. What would the second ratio of the proportion look like if the first proportion is as follows?

Answers

Answer:

8 adults

Step-by-step explanation:

24 / 3 = 8

Answer:

\frac{Students}{Adults}  

3 students and 1 adult - [tex] \frac{3}{1}

24 students and x adults - [tex]\frac{24}{x}

After solving the answer is 8 adults to 24 kids

Hope this helps:)

Step-by-step explanation:

Rapid Rental Car charges a $45 rental fee, $15 for gas, and $0.75 per mile driven. For the same car, Capital
Cars charges $40 for rental and gas and $0.85 per mile.
Part 1 out of 2
For how many miles is the rental cost at both companies the same?
The rental costs at both companies are the same at|
Check
miles.

Answers

Your total cost will be 80

at 100 miles the costs are the same

​'s car can go miles on gallons of gas. During a drive last​ weekend, used of gas. How far did ​drive? Use pencil and paper. Explain how the problem changes if you were given the distance drove last weekend instead of how much gas used. PLEASE HELPP!!!

Answers

Answer: 155

Step-by-step explanation:

Given :

Writing lan's car can go 296 miles on 8 gallons of gas.

During a drive last weekend, lan used

7 gallons of gas.

To find :-

How far did he drive?

Solution :-

According to Question ,

Car can go 296 mi on 8 gallons of gas.

Using Unitary Method ,

On 1 gallon of gas it will go 296/8 mi

On 7 , it will go 296/8*7 = 259 miles

Hence the required answer is 259 miles .

>>>>>>>>>>>>>>>>>>>>>>>>>>>>....

Answers

Answer:

The first one is $1.19 for each balloon.

Second one is 7 months.

Step-by-step explanation:

1. 19.63 - 12.49 = 7.14 < (the cost of all six balloons) 7.14 divided by 6 = $1.19

2. 1,250 - 65 = 1,185 - 65 = 1,120 - 65 = 1,055 - 65 = 990 - 65 = 925 - 65 = 860 - 65 = 795    You had to subtract 65 each month 7 times to get less then 800.

Hope this helps!! <3 I miss easy math :,(

What is the scale factor of this dilation?

Triangle A B C. Side A C is 8, C B is 10, A B is 6. Triangle A prime B prime C prime. Side A prime C prime is 4, C prime B prime is 5, B prime A prime is 3.
1/5
1/2
1
2
i need help please

Answers

Answer:

1/2 or 2

Step-by-step explanation:

If the original triangle length of Side A to C is 4, then the answer is two. If the original traingle length is Side A to C on the original triangle is 8, then the answer is 1/2.

The scale factor of the dilation is 1/2.

What is scale factor?

Scale factor is defined as the number or the conversion factor which is used to change the size of a figure without changing its shape. It is used to increase or decrease the size of an object. The scale factor can be calculated if the dimensions of the original figure and the dimensions of the dilated (increased or decreased) figure are known.

The basic formula to find the scale factor of a figure is expressed as,

Scale factor = Dimensions of the new shape ÷ Dimensions of the original shape.

Given:

Before dilation

AC= 8, BC= 10 abd AB= 6

After dilation

AC= 4, BC= 5 and AB= 3

Now, scale factor

Scale factor = Dimensions of the new shape / Dimensions of the original shape.

So,

scale factor = 4/8  or 5/10  or  3/6 = 1/2

Hence, the scale factor is 1/2.

Learn more about scale bhere:

https://brainly.com/question/22312172

#SPJ2

Help asap-----------------------------------------------

Answers

Answer:

84

Step-by-step explanation:

4x7x3 :D

(if im wrong please correct me)

84 I’m pretty sure I did this on a test

four times a number x is at least -12
an inequality is ?
the solution is ?

Answers

Answer:

-16

Step-by-step explanation:

im just taking a guess.

x+4>-12

  -4   -4

---------------

4's cancel out and -12+-4=-16

Again this is just a guess.

The inequality is 4x ≥ -12 and the solution of this inequality is x ≥ -3.

What are Inequalities?

Inequalities are the expressions having two sides connected with inequality symbols. Inequality symbols are <, >, ≤, ≥ and ≠. They may contain one or more variables and constants.

Inequalities which consist of one or more variables with the highest degree of the variables being 1 is called Linear inequalities.

Given that four times a number is at least -12.

Thus the inequality says that 4 multiplied with a number x, which is 4x has values -12 or greater than -12.

So the inequality is 4x ≥ -12.

Solving this,

4x ≥ -12

Dividing both sides by 4, we get,

4x/4 ≥ -12/4

x ≥ -3

Hence the inequality is 4x ≥ -12 and the solution is x ≥ -3.

To learn more about Inequalities, click on the link given below :

https://brainly.com/question/28823603

#SPJ2

Other Questions
how do i solve this? find the equation of the line that passes through the point (1,8) and is parallel to the line y=3x+6. write the equation using the slope-intercept form. -Democracy was introduced in Athens-The Romans created a representative democracy-the British implemented representative democracy-the United States has the longest running democratic republic in theworld.The list above describes the geographic concept of -a) cultural divergence b) spatial diffusionc) spatial assimilationd) human-environment interaction Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a New- Muhammad taught the belief that there is only one god and believed that the other Two Semitic religions (Judaism and Christianity) were ________.not relevant to current society.valid revelations from God but were distorted by man.not truly monotheistic religions.believed in the wrong God. What is one conclusion that can be synthesized from this selection?A) Students are usually hesitant to express their opinions to teachers. B) School administrators are out of touch with the needs of their students. C) Guidance counselors can offer helpful advice about a variety of life issues. D) Teachers are reluctant to listen to students' opinions about the books they teach. 2- some of your mates like Chinese cousin, don't they?Why we use some of at the first of the sentence!! Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? What are some real-life situations that require a program that is iterative? Include at least three examples in your answer. Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent M Yo can anybody please help me answer this question Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? Step 4: Is the function increasing or decreasing? Why?-It is increasing because the graph line points down and right and has a positive slope.-It is decreasing because the graph line points down and right and has a negative slope.-It is decreasing because the graph line points up and right and has a negative slope.-The function is neither increasing nor decreasing.-It is increasing because the graph line points up and right and has a positive slope. 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education Sally used 5 gallons of ginger ale, 1 gallon of orange juice, and 2 gallons of pineapple juice, to make a punch for her family holiday party. How manyquarts of punch will Sally have for her party?O 32 quartsO 52 quartsO 36 quarts12 quarts In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. how do you solve 2x