What is the purpose of the digestive system?

1. Create energy
2. Swallow food
3. Break down food so nutrients can be absorbed

Answers

Answer 1

Answer:

3. Break down food so nutrients can be absorbed

Explanation:

the reasoning is when you digest something your body is breaking down the food into small chuncks so that the nutrients can be absorbed easier

Answer 2
It would be #1&3. The digestive system is needed to break down food so nutrients can be absorbed. From there you body can create its energy.

not #2 - your mouth swallows not your digestive system

Related Questions

Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.


I need the answer no links and no putting random stuff I need the answer fast

Answers

Answer:Copper is a mineral commonly used in electronics. Copper ore deposits were created by volcanic activity. Heat and pressure creates copper ore and deposited it in sedimentary rock layers. Copper is considered a resource.

Explanion:

its already the answer

When the ocean absorbs CO2 it leads to what?

Answers

Explanation:

Each liquid falls somewhere along a scale with acid at one end and alkaline at the other. Normally, ocean water is less acidic than fresh water. Unfortunately, as the ocean absorbs more and more carbon dioxide from the atmosphere, it becomes more acidic. Lemon juice is an example of an acidic liquid.

Answer:

If the ocean absorbs a lot of CO2 it is most likely to become acidic

What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio​

Answers

The new cell has an increased surface area to volume ratio​ is a process that makes easier the exchange of materials across the surface of the cell (Option C).

What is cell division?

Cell division is the process by which cells generate new daughter cells, which may be due to mitosis or meiosis in higher organisms.

Cell division is able to increase the surface/volume ratio and therefore it facilitates the movement of materials in the resulting cells.

In conclusion, news cell has an increased surface area to volume ratio​and it makes easier the exchange of materials (Option C).

Learn more about the cell division here:

https://brainly.com/question/8283140

#SPJ1

WILL GIVE BRAINLIEST TO WHOEVER ANSWERS FIRST!!!!!
For the compound C₆H₁₂O₆, what type of bond would join the elements and why?

1. covalent because an electron is transferred from a C atom and O atom to a H atom.

2. covalent because electrons are shared between the C, H, and O atoms

3. ionic because an electron is transferred from a C atom and O atom to a H atom.

4. ionic because electrons are shared between the C, H, and O atoms

Answers

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

The atomic no. of carbon=6

Electronic configuration=2,4

The atomic no of H=1

E.C=1

The atomic no of O=8

E.C= 2,6

Therefore to attain octate state, they will share electrons

Answer:

4. Ionic bond because electrons are shared between the C,H and O atoms.

Explanation:

Took the test.

Need help ASAP! Will give brainliest;) NO links please, will report.

Which statement is part of Darwin’s theory of evolution by natural selection?

A). Acquired characteristics that are inherited are the cause of evolution.

B). The organisms that are the fittest are always largest and strongest.

C). The number of offspring is not related to fitness.

D). More offspring are produced than can possibly survive.

Answers

D

More offspring are produced than can possibly survive.

Using what you read in this passage, evaluate the following vacation
activities. Which one would cause the least disruption of the balance of
the coral reef?
A
Sport fishing on the reef
B
Scuba diving to view the reef species
с
Collecting rocks and shells as souvenirs
D
Attracting sharks to the reef with bait for photos

Answers

From the listed human activities, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

What are coral reefs?

Coral reefs are narrow and shallow stretches land where corals ate found and these corals serves as foundation for reefs to form.

The reef is an ecosystem consisting of algaes and fishes as well as some other aquatic organism.

The balance in coral reefs can be disrupted by human activities such as:

Sport fishing on the reefCollecting rocks and shells as souvenirsAttracting sharks to the reef with bait for photos

However, Scuba diving to view the reef species though disruptive, would produce the least disruption to the balance in the coral reef.

Learn more about coral reefs at: https://brainly.com/question/10970167

Who suggested that the distance of a galaxy is proportional to its recessional speed

Answers

Answer:

Edwin Hubble

Explanation:

Which gas is used by humans in the process of cellular respiration?

Answers

Answer: Oxygen

Explanation:

During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Hope This Helps!

#[tex]AnimePower[/tex]

Answer:

oxygen

Explanation:

we breathe it in during cellular respiration

blue, light blue, yellow, or red

HURRY

Answers

Answer:blue

Explanation:

the answer to the question is the color blue

Underground water is an example of

A) a hidden water source

B) a untapped water
source

C) an unusable water source

D) a high salinity water source

Answers

Answer:

i think its a hidden water source

what does arrows mean in science

Answers

It means that something lead to something else.like an chain reaction or in food chain wise this animal gains energy from this animal or plant

Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción

Answers

Sobre la pregunta:

Cucigrama. Pregunta 1 vertical. Absorbe nutrientes por medio de micro vellosidades que recubren y aumentan la superficie de absorción

Answer:

Intestino delgado

Explanation:

El intestino delgado es el organi mas largo del tubo digestivo, pudiendo medir 7 metros de longitud y 3 cm de diametro. Se caracteriza por estar sumamente plegado sobre si mismo. La primera porcion, llamada duodeno, recibe secresiones de glándulas biliar y pancreática, y las mezcla con enzimas digestivas. Esta mezcla se encarga de degradar la comida y transformarla en sustancias solubles, como amino ácidos.

Es en el intestino delgado donde ocurre la absorción de nutrientes.  Las paredes intestinales estas cubiertas por microvellosidades que aumentan la superficie de absorción.  

Las microvellosidades son células que componene el epitelio columnar, y que extienden proyecciones hacia el lumen del organo.  

 

Giving brainlist to whoever answers

Answers

Answer:

At the bottom of the food chain, the herbage, are the producers. All the other organisms above the producer are consumers. In economics, the food chain is the series of processes by which we grow, sell, and eventually consume food. This article focuses on the term when it refers to organisms that depend on each other as a source of food.

Explanation:

Answer:

heterotroph

Explanation:

Which feature must a community have in order to use wind energy?
A. An average elevation change of 20 feet per mile to allow the wind
to flow downhill
B. Molten rock near groundwater supplies
C. Nets to keep birds and bats away from the turbines
D. An average wind speed of at least 15 miles per hour and enough
land to build several wind turbines
PLEASE HELP ASAP

Answers

molten rocck near ground water supplies

A person is trying to solve the equation for the energy of a light wave: E=hcλ . She knows the values of h and c. What does the quantity λ represent?

A.
frequency
B.
wave speed
C.
period
D.
wavelength

Answers

Answerd

;-)◑__◐

Explanation:

Which part always comes FIRST in the scientific name?

Answers

Answer:

The first part of the scientific name is the genus, and it is always capitalized. (The plural is "genera"). The second part is the species epithet. The entire name is written in italics.

Explanation:

hope this helps

please help me with this​

Answers

Answer:

prob b

Explanation:

A, Gravity is a non contact force.

Explain how advancements in engineering and technology over the years have allowed scientist to learn about mars and earths moon.

Answers

Telescopes on Earth and in orbit around Earth provide scientists with information about our solar system. That information is used to plan where spacecraft fly and where they “point their cameras.” NASA and other agencies send robotic spacecraft to fly by, orbit, or land on other planets and moons.

In order for water to collect in earths atmosphere and form clouds it must first undergo what process?

A) condensation

B) convection

C) evaporation

D precipitation

Answers

Answer:

The answer is D: Precipitation

1. Which of the following best explains how
behaviors, such as swarming and flocking, help
protect organisms?
a. Individuals in swarms or flocks act as decoys
to distract predators.
b. The movement and size of the swarm
or flock confuses predators.
c. Working together in swarms or flocks
requires less energy
d.The size of most swarms and flocks
can overtake larger predators.

Answers

d

The size of most swarms and flocks can overtake larger predators.

What is likely to happen when there is more genetic diversity?

A The slower an individual adapts to its changing environment
B The more likely that some individuals will adapt to the changing environment
C The more offspring an individual will produce
D The more struggles an individual will have surviving

Answers

Answer:

b

Explanation:

if there is more genetic diversity then the organism will adapt much better to the environment around it

Answer:

B

Explanation:

ggggggggggggggggggggggg

PLS HELP! When I let go of a rock it falls down. What happens explain

Answers

Answer:

Gravity

Explanation:

Mark as Brainliest

what is the name of the fluid found in the gall bladder​

Answers

Answer:

"Bile" is what that fluid is called

What is the difference between a prokaryotic cell and a eukaryotic cell?

Answers

Answer:

Size is 0.1- 5.0 um Size is 5-100 um

Nucleus is absent Nucleus is present

Membrane-bound nucleus absent. Membrane-bound Nucleus is present.

Explanation:

here are some

Answer:

One difference is that prokaryotic has a membrane and a nucleus but on the other hand a eukaryotic cell's don't have one

Explanation:

Glad I could help! <3


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

_______________________ is an animal's ability to blend into its surroundings.

a
artificial selection
b
evolution
c
natural selection
d
camouflage

Answers

D camouflage I’m assuming because that’s what camouflage is used for.

[tex] \huge \color{magenta}{ \boxed{ \large \sf \color{blue}{d. \: Camouflage}}}[/tex]

Camouflage is the use of any combination of materials, coloration, or illumination for concealment, either by making animals or objects hard to see, or by disguising them as something else. Examples include the leopard's spotted coat, the battledress of a modern soldier, and the leaf-mimic katydid's wings.

Name three reasons why the atmosphere is important to life on earth and explain your reasoning.

Answers

The atmosphere ensures that all living things can carry out daily processes that are vital to survival, such as breathing. Photosynthesis, for example, could not be possible without an atmosphere, because all of the gasses in our atmosphere stay there due to Earth's gravity.

The atmosphere is vital because it plays a role in the water cycle as well, allowing rain to keep falling and giving life-giving water to organisms that need it.

Life would not be possible without an atmosphere on this planet, along with other vital things, like gravity, sunlight, and water.

Counting a few organisms with in a population and multiplying that number
to estimate the total size of a population is an example of *

Answers

Sincfhshjsnsheje jdhejdhdhdjdj

Cuales son las características anatómicas de las fosas nasales

Answers

El interior de las fosas nasales está tapizado por una membrana mucosa, que se divide en mucosa respiratoria y mucosa olfativa. La mucosa respiratoria (antiguamente pituitaria roja) recubre la mayor parte de la fosa nasal y contiene células ciliadas y células caliciformes que secretan moco.

20. What is true about the esophagus? Check all that apply.* ]

Answers

Answer: It is ten inches long, its does connect the nose too the lungs, I dont think about the last one

Explanation:

Other Questions
The length of a rectangle is 5 inches and the width is 7 inches. What is the area ofthe rectangle? Complete eachsentence with aform of one ofthe verbs fromthe list. Use eachverb once onlyafford, bear, continue, expect, happen, learn, love, offer, prefer, pretenda) John really ...lexes........ spending all day at the beach.b) I'm completely broke, so I can't ................... to go on holiday.c) Excuse me, but do you .................. to know the way to Old Street?d) We ...................... Our team to win, but they were badly beaten.e) Kate ..... to speak French and German when she was at school.f) Even when the examiner told him to stop, Bill ........... ... speakingg) I'm sorry, but I can't ................ to listen to this awful music!h) Last week George ...........to help me paint my bike.i) Paul ........... to have a bad leg so he didn't have to go to the gym.j). Sam usually ........ playing football to doing homework. I need this please help me i need help plz :( i dont understand Please help soon- The weight of oranges growing in an orchard is normally distributed with a meanweight of 6 oz. and a standard deviation of 1 oz. From a batch of 2500 oranges, howmany would be expected to weight less than 4 oz., to the nearest whole number? A phone case, which originallycosts $14.50, is on sale for 32% off.What is the cost of the phone caseafter the discount? ? Read the text below carefully and then answer the following question.Dominique sest leve onze heures ce matin. Mieux vaut tard que jamais.Frdrique na pas beaucoup travaill ce semestre mais Frdrique sest forc pour les examens et a russi. Quand on veut, on peut.Les Cordier ont pens finir lanne avec une mauvaise note et se sont disputes. Mais non. Ce qui prouve quil ne faut pas vendre la peau de lours avant de lavoir tu.Dominique woke up late. Vrai ou faux ?VraiFaux What is Islamaphobia? *O The only way to stop terrorismO Mistreatment of Muslims in the USO A new type of governmentO A disease that makes you allergic to Islam Kevin bikes to the pizza place for lunch. He rides 1 km east, 3 km north, 4 km west, and finally 3 km south. What was his displacement? plz help Draw the following triangle after a counterclockwise rotation about the origin. X+2y=0 12y= -6x Plzzz this is due 11:59 Someone please help me!!! Evaluate the following functions for f(-3)f(x)=-2[tex]x^{2}[/tex]-3x+7f(x)=[tex]x^{2}[/tex]+6x-8Numeric Answer Only. The demographic transition Theory helps explaina. why people moveb. how to gather the demographic statistics of a society c. how migration is related to pull factorsd. how population change is related to the technological development of a society Identify a second of transformations that maps triangle ABC onto triangle A"B"C in the image below. PLSPLSPLS HELP ME, I'LL GIVE BRAINLIEST AND SPAM YOUR ACC WITH 5 STARS 6. What happens when :a)manganese dioxide is heated with conc.hydrochloricacid. Please help me with this. And my teacher said to show your work so what do I have to do and she said on paper please help thank you! Which of these questions represents a debatable topic? Complete with imperfect: Ana, en los veranos yo ________ a la playa para vacaciones. *1 pointibavoyfuiir