Answer:
horizontal gene transfer
Explanation:
Horizontal Gene Transfer (HGT) can be defined as a non-sexual process that enables the exchange of genetic information between genomes. Although HGT mainly occurs between prokaryotic genomes, an increasing number of examples involving eukaryotic host genomes have recently been described. Agrobacterium bacteria are capable of transferring and integrating DNA into the genome of eukaryotic cell hosts by the HGT mechanism. The transference of genetic material via Agrobacterium-mediated transformation is widely used in biotechnology to generate plants with desired genetic sequences. In the last years, it has been shown that various bacterial species including Bartonella henselae Rhizobium etli or even Escherichia coli, are able to genetically transform eukaryotic cells under laboratory growth conditions. The genetic phenomenon of horizontal gene transfer has evolutionary significance since it enables to bypass barriers between kingdoms in order to acquire nucleotide sequences that may eventually have some adaptive advantage. Moreover, the mechanism of horizontal transfer challenges a narrow vision of the eukaryotic genome as a fixed entity.
5. Explain how interactions and trade with Europeans affected West Africa?
European Exploration Study Guide
Why did European countries compete for power in North America?
Economic—Gold, natural resources, and trade
Religious—Spread Christianity
Competitions for empire and belief in superiority of own culture
What were the obstacles faced by the explorers?
Poor maps and navigational tools
Disease and starvation
Fear of the unknown
Lack of adequate supplies
What were the accomplishments of the explorations?
Exchanged goods and ideas
Improved navigational tools and ships
Claimed territories
What regions of North America were explored and settled by France, England, and Spain?
Spain: Francisco Coronado claimed the Southwest of the present-day United States for Spain.
France: Samuel de Champlain established the French settlement of Québec. Robert La Salle claimed the Mississippi River Valley for France.
England: John Cabot explored eastern Canada.
What regions were explored by Portugal?
The Portuguese made voyages of discovery along the coast of West Africa.
How did the American Indians and Europeans interact with each other?
Spanish
Conquered and enslaved American Indians
Brought Christianity to the New World
Brought European diseases to American Indians
French
Established trading posts
Spread Christian religion
English
Established settlements and claimed ownership of land
Learned farming techniques from American Indians
Traded with American Indians
American Indians
Taught farming techniques to European settlers
Believed that land was to be used and shared but not owned
The hottest recorded temperature in history occurred in Death Valley, California, July 10, 1913. The temperature was recorded at 134°F. Convert this temperature to Celsius and Kelvin.
Answer:
134 degrees F to degrees Celsius is 56.667
134 degrees F to degrees Kelvin is 329.817
Explanation:
Formula for F to C= (134°F − 32) × 5/9 = 56.667°C
Formula for F to K= (134°F − 32) × 5/9 + 273.15 = 329.817K
Help me guys!! (Giving brainliest)
Answer: C
Explanation:
C because the cell membrane is semi permeable which means only certain substances can enter and exit.
What is a piscivore?
O An animal that eats fish
O An animal that eats plants
O Any fish species
O Any plant species
A peptide has the sequence of Gly-Ser-Glu-Leu-Ala-His-Gly-Arg-Leu-Ala-PheCys-Leu. (pKR=4.25, 6.0, 8.2, 12.5. Assume pKa’s of amino terminus and carboxyl terminus are 9.6 and 2.3, respectively.) The PI of the peptide is close to:_______
a. 7.1
b. 7.8
c. 5.1
d. 8.2
e. 10.3
Answer:
The correct answer is option a. "7.1".
Explanation:
One easy way to determine if a peptide sequence is acidic, basic or neutral is to check for the number of amino acid residues that are acidic, basic or neutral. In this case, most amino acid residues are neutral, which mean that under neutral conditions they have a pKa close to 7.0. Particularly, the content of 3 leucine, 2 alanine and 2 glycine residues determines that the peptide have a pI of around 7.1.
A strategy for fighting bacterial infections uses viruses. Viruses that infect bacteria are called bacteriophages. Phage comes from the Greek word for “eater.” Explain why it is not accurate to call a virus that kills bacteria a “bacteria eater." What happens when a virus attacks a cell?
help!!
Answer:
Viruses are not living organisms, and for that reason a bacteriophage virus does not feed on bacteria, but uses them to replicate, producing lysis of the bacterial cell in the process.
Explanation:
Viruses are structures formed by genetic material —DNA or RNA—covered by a protein envelope called the viral capsid. These structures do not perform the vital functions of a cell, so they are not considered living organisms.
A bacteriophage virus is characterized by using prokaryotic cells to replicate, destroying them in the process.
Viruses need a living cell to be able to replicate, so they introduce their viral genome into them to replace the genetic material of their nucleus and be able to multiply. They can do this:
Introducing the genetic material from outside the cell. Entering directly into the cell to be able to replicate.Bacteriophage viruses do not eat the bacteria, they simply use it to reproduce, and then happens the lysis of the bacterial cell.
Answer:
Viruses are not living organisms, and for that reason a bacteriophage virus does not feed on bacteria, but uses them to replicate, producing lysis of the bacterial cell in the process.
Explanation:
Let's suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular proteins would be the target of your drugs?
Answer:
Potential targets:
1- DNA methyltransferases
2- Chromatin modifiers such as histone acetyltransferases, histone deacetylases, histone methyltransferases, etc.
3- Components of the RNA interference (RNAi) machinery such as Dicer, Argonaute, etc.
Explanation:
Epigenetics can be defined as the study of any heritable change in the phenotype that does not involve modifications in the DNA sequence. Epigenetic mechanisms can be classified into three major types: 1-DNA methylation, 2-histone modifications (e.g., acetylation, methylation, phosphorylation, etc), and 3-regulatory non-coding RNAs (e.g., miRNAs, lncRNAs, siRNAs, etc) that modulate target gene expression via the RNA interference pathway. There are different types of proteins that are involved in these complex epigenetic mechanisms, and those cited above represent only some examples that can be used as therapeutic targets.
Which of the following processes is driven by gravity?
1.) Evaporation 2.) Condensation
3.) Precipitation 4.) Freezing
Answer:
Precipitation
Explanation:
The process which is driven by gravity is precipitation. In the process of precipitation, the clouds formed by evaporation of water drops off in the form of rain. Thus, the correct option is 3.
What is Precipitation?Precipitation is one of the main processes of water cycle. Water cycle is a biogeochemical cycle which involves the flow of water in the atmosphere through different processes such as evaporation, precipitation, and in different phases such as solids, liquids, and vapors.
Precipitation is the process of water cycle in which the clouds formed by the evaporation of water drops off back to the land in the form of rain. This process is driven by the influence of gravitational force.
Therefore, the correct option is 3.
Learn more about Precipitation here:
https://brainly.com/question/18109776
#SPJ2
a. What is the major evolutionary advantage to producing an amnion?
b. What does that mean for embryonic development for the animal phylum as compared to the animal phyla?
WHAT IS THE MAJOR EVOLUTIONARY ADVANTAGE TO PRODUCING AN AMNION?
The main evolutionary advantage of producing an amnion is that the embryos of the amniotic membrane,the amniotes are made available with their own aquatic environment,this in-turn resulted to a lesser dependence on water for it's maturation and development therefore allowing or giving room for the amniotes to branch towards environments that are drier.
WHAT FOES THAT MEAN GOR EMBRYONIC DEVELOPMENT OF THE ANIMAL PHYLUM AS COMPARED TO THE ANIMAL PHYLA?
The embryonic development of animal phylum is also known as embryogenesis.
It is the development of the embryo from the point of fertilization of an egg,(the ovum) by a sperm cell ,this makes the fertilized egg a diploid cell otherwise known as a zygote.
This zygote undergoes mitosis,a mitotic division known as cleavage and a differentiation resulting in a multicellular embryo.
This embryonic development of animal phylum comprises of 36 animal phyla.
Which of the three traits considered in this film (bipedality, extensive tool use, and large brains) were present in the 3.2-million-year-old Australopithecus fossil (Lucy)?.
Answer:
The bipedality
Explanation:
One of the things the discovered fossil signified was that human bipedality was more ancient than the large brain size because Lucy actually had a small skull which could indirectly be translated to small brain size.
NOTE: Bipedality can be described to mean the ability of an organism to move about with two legs. Hence, it must have been discovered that Lucy had two legs.
Plzzzzz help I’ll mark brainliest
Answer:
Im pretty sure its B
Explanation:
Ecology.
The definition of ecology is: the branch of biology that deals with the relations of organisms to one another and to their physical surroundings.
This means that it is the study of how organisms interact with each other and their environment.
Not sure if it's right? Let's take a look at the other answers.
Definition of biosphere: the regions of the surface, atmosphere, and hydrosphere of the earth (or analogous parts of other planets) occupied by living organisms.
Definition of biotic: relating to or resulting from living things, especially in their ecological relations.
Definition of biome: a large naturally occurring community of flora and fauna occupying a major habitat, e.g. forest or tundra.
Hope this helps!
#LearnwithBrainly
Which purpose does a cell membrane play in eukaryotic cells?
The cell membrane controls the movement of substances in and out of cells and organelles. In this way, it is selectively permeable to ions and organic molecules.
What 3 traits have led to human evolution? And why?
Answer: bipedalism, brain expansion, and culture
Explanation:
The increase in the reproductive success of a species will have the greatest impact on the - size of that species’ population. competition within other communities in the biosphere.. success of other populations in the community. tissues that comprise organisms of that species.
Answer:
size of that species’ population.
Explanation:
The increase in the reproductive success of a species will have the greatest impact on the size of that species’ population.
A reproductive success rate means more individuals survive birth and get added to the existing population. The more the number of individuals added to a population, the more the size of the population of the species.
An increase in the population size of a species will only increase intra-species competition for resources but have no real impact on the success of other populations in the community.
find the value of x and y if (x,5)=(3,y)
Answer:
x = 3
y = 5
Explanation:
You associate the placement of the variables with their values.
Which types of rocks can become metamorphic rock?
both igneous and metamorphic rock
clastic sedimentary rock
both igneous and sedimentary rock
clastic or chemical sedimentary rock
Answer:
both igneous and metamorphic rock I believe
Explanation:
I I learned this in fourth grade I'm not sure if I'm correct if I remember correctly then it's these two sorry if it's wrong also tell me if it's wrong I'll try to tell you the right answer if it is wrong okay
Answer:
igneous, sedimentary, metamorphic all can
Explanation:
Which type of rock does B represent?
Group of answer choices
SOMEONE PLEASE HELP MEEEE you don’t have to explain just tell me if it’s true or false
Answer:
7. True
8. False
9. True
10. True
Explanation:
. How are mineral deposits formed around vents?
Answer:
When hot, metal-laden water spews from vents and mixes with the cold ocean, the metals precipitate. Large piles of sulfide accumulate on the seafloor and are eventually buried by sediments, modified by heat and pressure in the crust, and uplifted. Some are exposed on land when erosion removes the overlying rocks.
Determine the identity of an atom
Answer:
The number of protons in one atom of an element determines the atoms identity.
7. Chemical or physical factor that determines the number
of organisms in a population
Answer:INTERSPECIFIC COMPETITION
Explanation:
The physical factor that determines the number of organisms in a population is ; Interspecific competition
Interspecific competition in a population is a competition that exists between organisms of different species, while the competition that occurs within organisms of the same specie is termed intraspecific competition.
During Interspecific competition the different species compete for food, water and Habitat which every organism needs to survive, and in most cases the stronger specie overruns the weaker species and this will lead to the depletion in the number of the organisms of the weaker specie and an increase in the number of the stronger specie within the population.
Hence we can conclude that The physical factor that determines the number of organisms in a population is ; Interspecific competition .
Learn more : https://brainly.com/question/1638475
Suppose you find a yellow piece of metal in a stream. How could you tell if it’s real gold?
Answer:
Bite it, if it is soft then its gold
also if it is not shiny
Explanation:
1. Does a scientific theory ever become a law? Explain
the difference between scientific theory and law.
Answer:
a theory cannot become a law
Explanation:
the difference between a scientific theory and a scientific law because a theory is an in depth explanation of an observed phenomenon. a law is a statement about an observed phenomenon or an unifying concept (i.e.: newtons law or gravity - no explanation on how it works or what it is just that it exists.)
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
GTTCAAGCTACTGTTCAAGCTACT
Which type of rock is non-foliated metamorphic rock?
Answer:
slate, phyllite,schist and gneiss
Answer:
Letter A: Gneiss
Explanation:
particles is found in the nucleus of an atom
Answer:
protons and neutrons
Explanation:
Protons and neutrons have a positive and neutral charge, respectively. They are in the nucleus, while the negative electrons orbit the nucleus.
Answer:
Protons, neutrons, electrons
Explanation:
If you're asking about subatomic particles.
An aqueous solution of compound x has a ph of 12. which of the following is a possible identity of compound x?
Answer:KOH
Explanation:An aqueous solution of compound X has a pH of 12. Which of the following is a possible identity of compound X?
What has helped the ecosystems survive through the Earth's changes?
Human activity
Biodiversity
Machines
Mr. Attis
Answer:
its human activity that change ecosystems
Ecosystem survival during earth change is helped by biodiversity, which produces a quality environment, hence option b is correct.
What factors affect the ecosystem?Ecosystem drivers encompass both natural and human-made elements. For example, habitat change and over-exploitation are direct causes that overtly affect ecological processes.
The effects of human activities on land and in the sea may have a significant impact on ecosystems. Among the various issues that ecosystems face include climate change and ocean acidification.
Biodiversity produces a quality of the environment that combine with oxygen, clean air, and water, pollinates plants, controls pests, treats sewage, and provides a wide range of other ecosystem services.
Therefore biodiversity provides an environment for the ecosystem when the earth changes, hence option b is correct.
Learn more about the ecosystem, here:
https://brainly.com/question/13960524
#SPJ2
Which of the following situations best describes the use of a renewable resource?
A
filling a car with gasoline
B
building wooden furniture
С
mining copper
D
burning coal in a power plant
according to the diagram the temperature where clouds form is?
Answer:
higher than the temperature near mountains
Explanation:
Answer: C. lower than the temperature on the ground
Explanation: Because on the chart it shows the temp on the ground is 92° but then the temp where clouds form is 60°. This means that the temp at the ground is higher than the temp at 6000ft.