what is the probability that two randomly generated strings of length 9 in the dna alphabet ({a, c, g, t}) are identical?

Answers

Answer 1

The probability that two randomly generated strings of length 9 in the DNA alphabet is 729.

We have to find the probability that two randomly generated strings of length 9 in the DNA alphabet (a, c, g, t) are identical.

Probabilities are based on occurrences, and events can result from one or more observations or experiment results.

The total number of alphabet in word DNA is 3.

So, the probability that two randomly generated strings of length 9 in the DNA alphabet = 9 × 9 × 9

The probability that two randomly generated strings of length 9 in the DNA alphabet = 729

To learn more about probability link is here

brainly.com/question/14210034

#SPJ4


Related Questions

In this figure, 12. 2% of the area is painted blue. How much of the area is painted blue? 1. 22 cm² 3. 05 cm² 4. 27 cm² 5. 49 cm² A square with side lengths of 5 cm. A triangle attached to one side has a perpendicular line indicating a height of 4 cm

Answers

12.2 % of the area painted blue of the figure representing a square with attached triangle on one side with perpendicular height 4cm is equal to 4.27 cm² .

Figure having square attached with triangle on one side.

Side length of the square = 5 cm

Area of the square = ( side-length )²

                                = 5²

                                = 25 cm²

Triangle attached on one side of the square with height = 4cm

Area of the triangle = ( 1/2) × base × height

                                = ( 1/2) × 5 × 4

                                = 10 cm²

Total area of the figure = 25 + 10

                                      = 35 cm²

Percent of area painted blue = 12.2% of total area

                                               = ( 12.2 / 100 ) × 35

                                               = 4.27 cm²

Therefore, for the given figure made up of square and triangle area to be painted blue is equal to 4.27 cm².

Learn more about area here

brainly.com/question/27683633

#SPJ4

Find the mean, median, mode, and range for each data set given.
a. 7, 12, 1, 7, 6, 5, 11
b. 85, 105, 95, 90, 115
c.15, 11, 11, 16, 16, 9

Answers

Answer:

Answers are in bold

Data set A:

Mean: 7

Median: 7

Mode: 7

Range: 11

Data set B:

Mean: 78

Median: 95

Mode: No mode or all the numbers (85, 105, 95, 90, 115)

Range: 30

Data set C:

Mean: 13

Median: 13

Mode: 11 and 16

Range: 7

Step-by-step explanation:

You're welcome.

a factory (f) is producing smoke that causes damage of $80 per month to a local residents laundry (l). the damage can be eliminated in one of two ways:

Answers

The following two methods can be used for eliminating the damage to the laundry (l).

Factory (f) can install a scrubber at a cost of $500 to reduce the smoke, thereby eliminating the damage to the laundry (l).Local resident (l) can purchase and install a clothesline at a cost of $100, thereby eliminating the damage to their laundry.

The factory and the local resident must decide whether to install the scrubber or the clothesline, depending on which option will result in the lowest cost. The best option for each party depends on their own willingness to pay for the damage reduction and their ability to pay for the solution.

To learn more about eliminating here:

https://brainly.com/question/12260198

#SPJ4

The growth rate of a bacterial culture is 150% each hour. Initially, there are 10 bacteria. Describe the error in finding the number of bacteria in the culture after 8 hours. Correct the error and find, to the nearest whole number, the number of bacteria in the culture after 8 hours. The exponential function is b(t)=. After 8 hours, there are about bacteria in the culture

Answers

If the growth rate of bacterial culture is 150% each hour , then the correct exponential function is b(t) = 10(2.5)^t instead of b(t) = 10(1.5)^t , and after 8 hours there are about 15259 bacteria in culture .

The percent growth in the bacterial culture is = 150% = 1.5  ;

the initial amount of bacteria present is = 10  ;

the exponential function used to denote this situation is written as :

⇒ b(t) = 10(1 + 1.5)^t

⇒ b(t) = 10(2.5)^t

to find number of bacteria after 8 hours ,

we substitute t = 8 in b(t) ;

we get ;

⇒ b(8) = 10(2.5)⁸ ;

⇒ b(8) = 15258.789 ≈ 15259

Therefore , there will be 15259 bacteria present after 8 hours .

The given question is incomplete , the complete question is

The growth rate of a bacterial culture is 150% each hour. Initially, there are 10 bacteria. Describe the error in the data below, in finding the number of bacteria in the culture after 8 hours. Correct the error and find, to the nearest whole number,

"The number of bacteria in the culture after 8 hours. The exponential function is b(t) = 10(1.5)^t ,  b(8) = 10(1.5)⁸ . After 8 hours, there are about 256 bacteria in the culture ."

Learn more about Exponential Function here

https://brainly.com/question/26052830

#SPJ4

PLEASE HURRY I HAVE LIMITED TIME!

Question- Find the standard form equation of a circle given a center of (7, 14) and a point on the circle of (4, 15).
Answers-
A.(x-7)^2 + ( y-14)^2 = 10
B.(x-7)^2 + (y-14)^2 = 15
C.(x-7)^2 + (y-14)^2 = 25
D.(x+7)^2 + (y+14)^2 = 2

Answers

Answer:

A

Step-by-step explanation:

R = sqrt((7-4)^2+(14-15)^2)=sqrt(10)

The answer is A since that's the only answer with the proper radius, using the formula for a circle.

can someone help me out
answers
2 units
3 units
5 units
7 units

Answers

The length of PT is 3 units. The solution has been obtained using the concept of transformation.

What is transformation?

A transformation is an operation that moves a polygon or other two-dimensional object on a plane or coordinate system.

The term "pre-image" or "inverse image" refers to the shape in two dimensions prior to any modification. The image is the shape after transformation.

Transformation can be done by translation, rotation, reflection and dilation.

We are given two rectangles ABCD and PRQT

AB = DC = 3 units

AD = BC = 10 units

It can be observed that the rectangles PRQT and ABCD are same but PRQT is rotated.

Since, they are same so,

AB = PT = 3 units

Hence, the length of PT is 3 units.

Learn more about transformation from the given link

https://brainly.com/question/17311824

#SPJ1

Evaluate the expression for the given value of the variables.

0.5c−2.3d

c=15​, d=3
DUE IN 20 MIN

Answers

Answer:

I got 0.6

Step-by-step explanation:

plug in c and d

0.5(15) - 2.3(3)

multiply them

7.5 - 6.9 = 0.6

Deepak is a landscaper who charges $30 for each job he does plus an additional $15 for each hour he works. He only accepts jobs if he will earn at least $90 per job. He writes this inequality to determine x, the number of hours he must work during each job in order to accomplish this.

30 + 15 x greater-than-or-equal-to 90

Which best describes the restrictions on the jobs Deepak will accept?

Answers

Answer:

He only accepts jobs that last 4 or more hours.

Step-by-step explanation:

He only accepts jobs that last 4 or more hours.

He only accepts jobs that last 5 or more hours.

He only accepts jobs that last 8 or more hours.

He only accepts jobs that last 9 or more hours.

30 + 15x ≥ 90

15x ≥ 60

x ≥ 4

Answer: He only accepts jobs that last 4 or more hours.

An investor has an account with stock from two different companies. Last year, his stock in Company A was worth $3300 and his stock in Company B was worth $4140. The stock in Company A has increased 4% since last year and the stock in Company B has increased 5%. What was the total percentage increase in the investor's stock account? Round your answer to the nearest tenth Answers fast!

Answers

The total percentage increase in the investor's stock account was of 4.55%.

The values of the stocks of Company A and Company B, after the increase are given, respectively, by:

Company A: 3300 x 1.04 = $3432.

Company B: 4140 x 1.05 = $4347.

The total values are given as follows:

Before the increase: 3300  + 4140 = 7440.

After the increase: 3432 + 4347 = 7779.

The percent increase is given by the increase divided by the initial value and multiplied by 100%, hence:

P = (7779 - 7440)/7440 x 100% = 4.55%.

The total percentage increase in the investor's stock account was of 4.55%.

Learn more about percentage here :-

https://brainly.com/question/29306119

#SPJ4

Macy made a 220 grooming dogs one day in her mobile grooming business she charges 60 per appointment and 40 earned in tips write an equation to represent the situation and solve the equation to determine how many appointments Messi had part B Logan made a profit of 300 as a mobile groomer he charge $70 per appointment and received $50 in tips but he had to pay a rental fee for the truck of $20 per appointment write an equation to represent the situation and solve the situation to determine how many appointments Logan had

Answers

Macy had 3 appointments.

Logan had 5 appointments.

What is the quadratic equation?

A quadratic equation is a type of polynomial equation of degree 2, which is written in the form of "ax^2 + bx + c = 0", where x is the variable and a, b, and c are constants. The solutions to a quadratic equation can be found using the quadratic formula: x = (-b ± √(b^2 - 4ac))/2a.

Part A:

Let x be the number of appointments Macy had.

We know that the total income (60x + 40) must equal 220.

Therefore, the equation representing the situation is:

60x + 40 = 220

To solve for x, we can subtract 40 from both sides:

60x = 180

Finally, we divide both sides by 60 to get:

x = 3

Macy had 3 appointments.

Part B:

Let y be the number of appointments Logan had.

We know that the total profit (70y + 50 - 20y) must equal 300.

Therefore, the equation representing the situation is:

50y + 50 = 300

To solve for y, we can subtract 50 from both sides:

50y = 250

Finally, we divide both sides by 50 to get:

y = 5

Logan had 5 appointments.

To learn more about quadratic equations, Visit

https://brainly.com/question/1214333

#SPJ1

A right rectangular prism measures 12 cm tall, 3 cm long, and 10 cm wide. A manufacturer would like to double the surface area of this prism. What should be the height of the new prism so that its surface area is doubled? Enter your answer, to the nearest tenth, in the box.

Answers

The height of the new prism so that its surface area is doubled will be 26.31 cm.

What is the surface area of the rectangular prism?

Let the prism with a length of L, a width of W, and a height of H. Then the surface area of the prism is given as

SA = 2(LW + WH + HL)

A right rectangular prism measures 12 cm tall, 3 cm long, and 10 cm wide. A manufacturer would like to double the surface area of this prism.

Then the height of the new prism so that its surface area is doubled will be given as,

2 x 2 x (12 x 3 + 3 x 10 + 10 x 12) = 2(3h + 3 x 10 + 10h)

2(36 + 30 + 120) = 13h + 30

372 = 13h + 30

13h = 342

h = 26.31 cm

The height of the new prism so that its surface area is doubled will be 26.31 cm.

More about the surface area of the rectangular prism link is given below.

https://brainly.com/question/14987814

#SPJ1

Suppose that the height H of a Ferris wheel can be modeled by the function H(t) = -12cos(πt/45) + 18, where t is the time in seconds. What is the maximum height of a cabin? Use 3. 14 for π. ​

Answers

For the given function H(t) = -12cos( πt/45 ) + 18 the maximum height is  30 units.

Function to modeled the height 'H' of the Ferries wheel is given by:

H(t) = -12cos( πt/45 ) + 18

Where 't' represents the time in seconds.

For cosine trigonometric function,

-1 ≤ cosα ≤ 1

Here cos function lies between two values -1 and 1.

Substitute cos( πt/45 ) = 1 or -1

When cos( πt/45 ) = 1

H(t) = -12(1) + 18

⇒H(t) = 6 units

When cos( πt/45 ) = -1

H(t) = -12(-1) + 18

⇒H(t) = 30 units

Maximum height of a required cabin is equals to 30 units.

Therefore, the maximum height of given cabin represented by the function

H(t) = -12cos( πt/45 ) + 18 is equal to 30 units.

learn more about maximum height here

brainly.com/question/11535666

#SPJ4

6x−10y=-40 in slope intercept form

Answers

The answer is in slope intercept form is

Y=3/5x+4

Solve pleaaase i really need help

Answers

The equation of the model is (b) 2x = 5

How to determine the equation of the model?

From the question, we have the following parameters that can be used in our computation:

Left = x x

Right hand side = 1 1 1 1 1

The above parameters mean that

Left = 2x

Right = 5

When represented as an equation, we have

2x = 5

Hence, the equation is (b)

Read more about equations at

https://brainly.com/question/2972832

#SPJ1

Need Help ASAP!!!! 15 POINTS

Answers

Using Quadratic formula, the roots of the equation are -11 + √217/6, -11 - √217/6 .

Equations involving quadratics The definition of a quadratic as a second-degree polynomial equation demands that at least one squared term must be included. It also goes by the name quadratic equations. The quadratic equation has the general form ax2 + bx + c = 0.

Any quadratic problem can be solved using the quadratic formula. The equation is first changed to have the form ax2+bx+c=0, where a, b, and c are coefficients. After that, we enter these coefficients into the following formula: (-b(b2-4ac))/(2a).

Using Quadratic formula,

3x² + 11x - 8

(-b±√(b²-4ac))/(2a)

⇒ (-11 ± √11² - 4(3)(-8)/2(3))

⇒ -11 ± √217 / 6

-11 + √217/6, -11 - √217/6

To learn more about Quadratic equation from given link

https://brainly.com/question/1214333

#SPJ1

5. while performing a starch test on several different cookie brands, four tests result in the typical black color of starch presence, but the fifth gives a yellow-brown color. how might you interpret this result?

Answers

Starch and protein levels are checked for In order to present the idea of chemical compound variety, it is necessary to test for the presence of starches and protein macromolecules.

Hypothesis: It is a negative result if the biuret reagent remains blue after a test for protein since the reagent itself is blue. The test for protein is positive if a solution is pinkish purple or purple. The starch test solution is a yellowish brown color. We utilized iodine to test for starch in some solutions if any ingredient produced a mixture that was yellowish brown in color. Polysaccharides, monosaccharides, and disaccharides are separated from starch by iodine. Iodine interacts with molecules, changing the color of the molecules, while starch is a coiled polymer of glucose.

know more about starch here

https://brainly.com/question/14278135#

#SPJ4

how many 9-digit integers contain exactly 5 zeroes? (recall that the leading digit is never zero! you may enter a formula or an exact numerical value.)

Answers

Considering that the leading digit is never zero , then the number of 9 digit integers that can contain exactly 5 zeroes are 367416 numbers   .

the number of digits in the number is = 9 digits ;

the number should have exactly five zeroes  ,

the number of ways to pick five of the digit positions for the zeroes, since the first digit can’t be zero is  = ⁸C₅ ,

There are 9 possible digits for each of other 4 positions as  other positions are occupied by 0 ,

So, the total number of possibilities is = ⁸C₅ × 9⁹⁻⁵

Simplifying further ,

we have ,

= ⁸C₅ × 9⁴

= 56 × 6561

= 367416 numbers .

Therefore , there can be 367416 numbers of 9 digits having 5 zeros .

Learn more about Numbers here

https://brainly.com/question/10642652

#SPJ4

free bilirubin is transported by the blood to the liver. TRUE OR FALSE

Answers

True, free bilirubin is transported by the blood to the liver.

Macrophages begin the disposal of hemoglobin by separating the heme from the globin. They hydrolyze the globin into free amino acids, which can be used for energy-releasing catabolism or recycled for protein synthesis.

Bilirubin

Bilirubin is a red-orange compound that occurs in the normal catabolic pathway that breaks down heme in vertebrates. This catabolism is a necessary process in the body's clearance of waste products that arise from the destruction of aged or abnormal red blood cells.

Hemoglobin

Hemoglobin is a protein in your red blood cells that carries oxygen to your body's organs and tissues and transports carbon dioxide from your organs and tissues back to your lungs.

Learn more about bilirubin here :-

https://brainly.com/question/28287289

#SPJ4

Week 23-Practice 19: Surface Area (PA.GM.2.1 & PA.GM.2
A cylinder has a surface area of 48 cm² and a radius of 2 cm. What is the height of the cylinder?
O 8 cm
O 10 cm
O 12 cm
O 14 cm

Answers

The lateral surface area of the cylinder is 51.22 cm2.
What is surface area?
Surface area is a two-dimensional measure that refers to the total area of a surface, such as the area of a two-dimensional shape, a three-dimensional solid, or a combination of both. It is the sum of the areas of all the faces of a solid object. It is also referred to as the area of the boundary of a three-dimensional object. It can be used to calculate the volume of an object, and is also used in other calculations like area of the base of a triangle, area of a circle, and more.

The cylinder shown below has a diameter of 5.2 cm on the base and a height of 7.1 cm. The diameter of the base is referred to as 'd' and the height of the cylinder is referred to as 'h'. The lateral surface area of the cylinder can be found by using the formula LSA = 2πrh, where 'r' is the radius of the base. The radius of the base of this cylinder is half of the diameter, or 2.6 cm. Therefore, the lateral surface area of the cylinder is: 2π x 2.6 x 7.1 = 51.22 cm2.

To know more about surface area click-
https://brainly.com/question/1297098
#SPJ1

Please help will give brainliest

Write a letter to a student who will be taking this math class next year and give them some advice about this class

Answers

A letter to a student who will be taking this math class next year to give them some advice about this class has been written below.

(Sender's address)

20/01/2023

Dearest,

I was happy to see your letter, and I hope this letter finds you in the best of health. I have wanted to go on a trip with you for a long time but I guess that would happen later since you have to start attending classes soon.

I have a list of things to keep in mind when you start your classes. I was always too scared of mathematics, and I know you are too, but I have always wanted to tell you how fruitful it is to learn a subject that will help you in every field you want to go in. Let me know what you think about it after you finish reading this letter. I know it is no secret that maths is a difficult subject but you can master it if you keep what I am going to tell you in mind. Practice your concepts daily. Keep brushing up on whatever your teacher teaches you. Remember the formulas and you will know how to answer any question.  I know for sure that it is going to be worth it too.

I will make sure that I meet you next weekend so that we can meet before you begin the classes. If you try hard, you can make this work. See you soon.

Love,

(Sender's name)

Learn more about letter writing on

https://brainly.com/question/24297273?referrer=searchResults

#SPJ4

what is the axis of symmetry of this graph?

Answers

Answer:

The axis of symmetry is x = -3.

If you draw a line at x = -3, the graph is reflected over it.

Jacob has 6. 15 meters of rope. He is going to use 1. 2 meters of rope to tie up his boat. How many centimeters of rope does he have left?

Answers

The remaining rope he left is 495cm

Now, According to the question:

Multiplication is an operation that represents the basic idea of repeated addition of the same number. The numbers that are multiplied are called the factors and the result that is obtained after the multiplication of two or more numbers is known as the product of those numbers.

Jacob has 6. 15 meters of rope.

He is going to use 1. 2 meters of rope to tie up his boat.

When you do the subtraction, whatever is left (the decimal part) is the length in cm when multiplied by 100.

Remaining rope = starting length - what was used.

Remaining rope = 6.15 - 1.2

Remaining rope = 4.95 meters

Hence, The remaining rope he left  = 4.95 × 100 = 495 cm

Learn more about Multiplication at:

https://brainly.com/question/5992872

#SPJ4

Determine whether the pairs of triangles are congruent.

Answers

Answer:

1. yes

2. No

Step-by-step explanation:

1. The triangles are congruent

2. It's not matching

The triangle below is equilateral. Find the length of side x to the nearest tenth.
x
12

Answers

Answer:

Step-by-step explanation:

What are the domain and range of f (x) = -5/6 (x + 2)^2 - 8?

Answers

Answer:

Option B

Domain: all real numbers

Range [tex]f(x) \le -8[/tex]

Step-by-step explanation:

Given function is:
[tex]f\left(x\right)=-\dfrac{5}{6}\:\left(x\:+\:2\right)^2\:-\:8[/tex]

The domain is the set of all x values that result in a real and defined value for f(x).

The function has no undefined points and x is free to range from -∞ to +∞

So the domain is -∞ < x <∞ which is
All real numbers

The range is the set of all possible values for f(x) given a specific domain. In order to determine the range without too much hard work, let's first examine the function f(x)

The above function is the equation for a parabola.

Some things to note about a parabola equation:

The vertex form equation of a parabola is:
[tex]f(x) = a(x - h)^2 + k[/tex]
where the vertex is the point (h, k). So the x-value of the vertex = h and corresponding y-value is A vertex is the maximum or minimum point in the parabola If the coefficient a > 0 then the parabola opens upward and the vertex i(h, k) s a minimumIf the coefficient, a < 0 the parabola opens downward and the vertex (h, k) is a maximum

Let us compare the general vertex form equation of the parabola with the specific f(x) equation given

General Equation:    [tex]a (x - h)^2 + k[/tex]

This example:           [tex]-\dfrac{5}{6}\:\left(x\:+\:2\right)^2\:-\:8[/tex]

Comparing the similarity between the two equations we easily see that

[tex]\boxed{a = -\dfrac{5}{6}}[/tex]
This means the parabola opens downward and (h, k) represents a max point in the parabola

 


[tex]x - h = x + 2\\\\-h = 2\\\\h = -2\\[/tex]

[tex]k = -8[/tex]

So the vertex is at (-2, -8)

Since -8 is the maximum value for f(x), and the parabola extends to infinity on both sides, the range is :

[tex]\boxed{f(x) \le -8}[/tex]

The attached graph may help you understand better

Can someone help me please?

Answers

Answer:

Part A.) 153 Boxes

Part B.) 394 Boxes (395 if rounding up)

Step-by-step explanation:

The inequality used in this situation would be:

3.74x + 25 < 600

3.74 is the price of each box

x is the number of boxes

25 is that deposit

and < 600 is not making $600 in sales

What we need to do is get X alone. First we will subtract 25 from both sides since that's the opposite of +25.

Doing that will get you

3.74x = 575

Next step is to divide 3.74 on both sides since 3.74 is being multiplied by x and division is the opposite.

That will give you X = 153.74. We round down to stay under and we end up with 153.

For part B, we would do the same process, but instead of < 600, we would do >= 1500. Just typing the same steps out.

3.74x >= 1475 since we subtract 25 from both sides

x = 394.38 since we divide 3.74 on both sides. Rounding would get us 394

jane spent 2 hours exploring a mountain with a dirt bike. when she rode the 40 miles uphill, she went 5 mph slower than when she reached the peak and rode for 12 miles along the summit. what was her rate along the summit?

Answers

The time to calculate her rate along the summit Rate = 1.5 mph

Rate = Distance / Time

To solve this problem, we will first need to calculate the time it took Jane to reach the peak. Since she rode 40 miles uphill, we can use the rate of 5 mph slower than when she reached the peak to calculate this time.

Time = Distance / Rate

Time = 40 miles / (Rate - 5 mph)

Time = 40 miles / (Rate - 5 mph)

Time = 40 miles / (Rate - 5)

Time = 8 hours

Since Jane spent 2 hours exploring the mountain, the total time it took her to reach the peak was 8 hours. We can now use this time to calculate her rate along the summit.

Rate = Distance / Time

Rate = 12 miles / 8 hours

Rate = 1.5 mph

Learn more about total time here:

https://brainly.com/question/951637

#SPJ4

Assume that when adults with smartphones are randomly selected, 37% use them in meetings or classes. If 30 adult smartphone users are randomly selected, find the probability that exactly 19 of them use their smartphones in meeting or classes the probability is (Round to four decimal places as needed. ​

Answers

The probability of adults using smartphones in meetings or classes as per the randomly selected adults is equal to 0.3375.

Percent of randomly selected adults use smartphones in meetings or classes represents the probability of success 'p' = 37%

                                                                                 = 0.37

1 - p = 1 - 0.37

       = 0.63

Number of randomly selected adults use smartphone in meetings or classes represents sample size 'n'  = 30

Exactly 19 adults use smartphone represented by x

x = 19

Using binomial distribution :

Required probability is :

P(x) = ⁿCₓ× pˣ × ( 1 - p )ⁿ⁻ˣ

⇒P(x) = [ n! / x! (n - x)! ] × pˣ × ( 1 - p )ⁿ⁻ˣ

Substitute the values

⇒P(19) = [ 30! / 19! (30 - 19)! ] × 0.37¹⁹× ( 0.63 )³⁰⁻¹⁹

⇒P(19) = ( 30!/19! ×11! )  × 0.37¹⁹× ( 0.63 )¹¹

⇒P(19 ) = 0.3375

Therefore, the required probability of selecting exactly 19 adults who use their smartphones in meetings or classes is equal to 0.3375.

learn more about probability here

brainly.com/question/30034780

#SPJ4

An airplane takes off from the airport. After 2 minutes the plane is at 500 ft. Assume the plane continues at the same rate. The plane’s height and minutes above the ground are related to each other.

A. Write an equation for the situation.

Answers

An equation for the situation described above is h = 2m + 500.

How to write an equation to model this situation?

In order to write an algebraic equation that model this situation, we would assign a variable to the number of minutes after an airplane takes off from the airport and the plane’s height respectively, and then translate the word problem into algebraic equation as follows:

Let the variable m represent the number of minutes.Let the variable h represent the plane’s height.

Next, we would translate the word problem into an algebraic equation based on the fact that after 2 minutes the plane is at 500 feet as follows;

h = 2m + 500.

Read more on equation here: brainly.com/question/18912929

#SPJ1

Which of the following graphs represents the function g(x) = 3∛x – 1?

Answers

A graph which represent the function g(x) = 3∛x – 1 is: graph A.

How to graph the given function?

In Mathematics, a graph simply refers to a type of chart that is typically used for the graphical representation of ordered pairs on both the horizontal and vertical lines of a cartesian coordinate, which indicates the x-axis  and y-axis respectively.

Based on the information about this graph, it represents the following function:

Function, g(x) = 3∛x – 1

By rewriting the cube root in the above function, we have the following:

Function, g(x) = 3∛x – 1

Function, g(x) = 3(x^{1/3}) – 1.

Next, we would use an online graphing calculator to plot the given function as shown in the graph attached below.

Read more on a graph here: brainly.com/question/4546414

#SPJ1

Other Questions
Randomly selecting 20 cards out of 52 card deck, the probability of each outcome will be basically the same whether it is done with or without replacement 1TRUE OR FALSE? 1. 50cm of 0.5 mol/dm NaOH solution and 50cm of 0.5mol/dm HNO3 were mixed at 20c and stirred in a calorimeter with negligible heat capacity. The temperature of the mixture rose to 23.2c.the density of each solution is 1.0g/cm and the specific heat capacity of each solution is 4.18J/K/g.calculatei.the enthalpy for the neutralizationii.calculate the change in enthalpy per mole of water formed last year small manufacturing company netted $540,000 the net profit increased this year by 135% what is the net profit of the company this year Becky had net sales (all on account) in 2017 of $820000. At December 31, 2017, before adjusting entries, the balances in selected accounts were: accounts receivable $1000000 debit, and allowance for doubtful accounts $2120 debit. Becky estimates that 2% of its accounts receivable will prove to be uncollectible. What is the net realizable value of the receivables reported on the financial statements at December 31, 2017 there are 10 employees in a particular division of a company. their salaries have a mean of $70,000, a median of $55,000, and a standard de?viation of $60,000. the largest number on the list is $ 100,000. by accident, this number is changed to $ 1,000,000. which nims structure develops recommends and executes public information Using y = 6 - 2x, plot the ordered pairs from the table. Then graph the function represented by the ordered pairs and tell whether the function is linear or nonlinear. Part 1 out of 3 Complete the table. Input, x Output, y Check -1 3 Next a client who is taking an oral hypoglycemic daily for type 2 diabetes develops an infection with anorexia. which advice will the nurse provide to the client? a solution is prepared at that is initially in dimethylamine , a weak base with , and in dimethylammonium bromide . calculate the ph of the solution. round your answer to decimal places. find the area of region s . find the volume of the solid generated when region s is revolved about the horizontal line y How were the civillzation of huang river valley and the nile river valley similar using defined inputs to ensure that an algorithm or program is producing the expected outcomes, in the development process. Someone Help me Please. Your friendfinds the sum. Is your friend correct?Explain your reasoning.-3.7 + (-0.25) = | 3.7 | + | 0.25 | = 3.7 + 0.25 = 3.95 ntsam ProctorQuestion 2Animals have albinism if they are unable to produce the molecule melanin. The protein responsiblefor making melanin is tyrosinase.If this is the normal sequence for a section of the mRNA transcript for tyrosinase:GCUGAUAGUCCUAnd a rat has this version of the sequence:GUGAUAGUCCUIs this rat likely to have albinism? How do you know?Second letterFirst letterUAUUC.UUG}LeuCUUCUCCUACUGUCUPheUCCLeuAUUAUC lleAUAUCAUCGCCUCCCCCACCGACUACCACAAUG Met ACGGUUGCUProUACJSerThrAUAU Tyr UGC CysUAA Stop UGA StopUAG Stop UGG TrpGCAUTCACJCGUHisCGCCAGGIn CGGAAUAsnArgAGC SerAAGLYS AGG ArgGAUR GGUUCAGDUA DUA D10 ptsThird letter (PLEASE HELP) At a local print shop, 15 copies can be made for $6. At this rate, how much would it cost to make 35 copies??? what significance does the slight overlap of the van der waals surfaces have with respect to the structural relationships of the catalytic triad residues? puck b has five times the mass of puck a . starting from rest, both pucks are pulled the same distance across frictionless ice by strings with the same tension. part a compare the final kinetic energies of pucks a and b . compare the final kinetic energies of pucks and . ka Charles Mann argues that when European settlers moved westward into the interiorof the Americas, they did so in two waves:a) Disease and ecological disturbance.Ob) Conquest and settlement.Oc) Ecological recreation and interaction.d) Disease and exchange. according to the proponents of the quantity theory of money, can a change in the money supply m cause a change in the level of real gross domestic product y?