What is the percent of Nitrogen in NH3?

Answers

Answer 1

Answer:

82.244%

Explanation:

Answer 2

The mass percent is an important method which is used to calculate the concentration of a solution. The mass percent of nitrogen in NH₃ is 82.2%.

What is mass percentage?

The mass percentage of a particular component in a compound can be defined as the ratio of the mass of the particular component to the total mass of the compound.

The equation which is used to calculate the mass percentage is:

Mass percentage = Mass of the component / Total mass of the compound × 100

or

The mass percentage is also calculated as:

% Mass = Mass fraction × 100

Here the mass of 'N' = 14.00 g

The molar mass of NH₃ = 17.031 g/mol

% Mass of 'N' = 14.00 / 17.031 = 0.82

0.82 × 100 = 82.2 %

Thus the mass percentage of nitrogen is 82.2 %.

To know more about mass percentage, visit;

https://brainly.com/question/27429978

#SPJ7


Related Questions

explain with example the combination and decomposition reaction.​

Answers

Answer:

Decomposition reactions require an input of some form of energy. For example, under the influence of an electric field, water breaks down to give hydrogen and oxygen. In the presence of sunlight, hydrogen peroxide decomposes into oxygen and water.

when 45mL of 0.25mol/L sulfuric acid is mixed w/ 25mL of 0.58mol/L Calcium hydroxide, the solution has a?

Answers

Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong. Pls pls help I don’t have time HELP ASAP. It also detects if it’s right or wrong.

scientific notation, fill in the blank.

7.95x10^7 = [ ? ]x 10^6

Answers

Answer:

79.5

Explanation:

7.95x10^7 IS 79500000.

If you bring the decimal point left 6 more times it would be 79.500000

If the gas tap to the Bunsen burner is turned on, the methane does not start burning until it is lit with a match. Why is heat from the match needed to start the methane burning?

Answers

Answer:

The reaction has a high activation energy

Explanation:

The burning of methane is a spontaneous reaction. Once the burning begins, the flame is able to sustain itself without any additional input of energy. It is an exothermic reaction in which energy is given out in the form of heat.

The reason why heat from the match is needed to start the burning of methane is that the activation energy of the combustion of methane is high. Activation energy is the energy that must be supplied in order for the collision of reactants to result in chemical reaction.

As long as the activation energy is high, the reaction can not occur without an external input of energy (e.g striking a match). Hence the answer.

what is chemistry?

in your own word please 2-3 sentence ​

Answers

Answer:

the science that deals with the properties, composition, and structure of substances they undergo, and the energy that is released or absorbed during these processes.

Explanation:

Answer:

Is the scientific branch that deals with the composition and decomposition of elements and compounds in nature

1. What is the basic unit of structure and function in a living thing
called?
2. How did the invention of the microscope help scientists learn
more about living things?
3. Who was the first to discover cells?
4. Draw a timeline that shows the dates, discoveries, and
scientists involved in the development of the cell theory.
5. What are the four statements of the cell theory?
6. What are specialized cells? List three examples.
7. What are four similarities that all cells share?
8. List the cell part for each letter on the diagram below. What is
the function of each part?

Answers

A,C,D,C,B,D,A,A...............!:!:!:$:$:$:$:$:$$:$:$;$;$

APE X What is happening to particles of matter while a change of state is taking place?
a. They are staying at the same speed
b. They are multiplying in number
c. They are slowing down
d. They are speeding up

Answers

Answer:

a. They are staying at the same speed

Explanation:

IF CORRECT PLSPLSPLS GIVE BRAINLIEST WOULD APPRECIATE :)

Answer:

a. They are staying at the same speed

what element has three valence electrons in the second energy level.​

Answers

Answer:

Boron

Explanation:

Hope that helps

Answer:

Boron.

Explanation:

2 energy shells

1st energy she'll 2 electrons

2nd energy shell 3 electrons

Explain why Chlorine has the largest electronegativity between Ne, Mg, Ba, Sb, Hg, Li?

Answers

Answer:

Look at the image provided and try work it out. I don't have the time but I hope I helped you!

Explanation:

People's actions can cause air pollution. People can plant trees to help reduce air pollution.
How does planting trees help reduce air pollution?
O A Trees take in nitrogen and dust.
B. Trees block sunlight from reaching the ground.
O c Trees produce oxygen and take in carbon dioxide.
D. Trees add nutrients to the soil that other living things need

Answers

Answer:

c

Explanation:

Please help!! This would mean so much to me!!

Answers

Answer:

I think it's the A one. Hope it's correct

Answer:

A option is correct

Explanation:

Please help

mg(oh)2
How many H atoms are there?
How many Mg?
What is the total number of atoms?

Answers

Answer:

There are 2 hydrogen atoms, one magnesium atom, and 5 atoms in total.

Explanation:

We are given a compound in formula form. To make things easier to understand, we can first convert this to the name of the compound.

When a compound contains one or more elements in parentheses, these are usually a polyatomic ion. Polyatomic ions are ions made up of two or more elements with a positive or negative charge over the entire ion. Commons examples of these NH₄⁺ (ammonia) and HCO₃⁻ (bicarbonate). You can combine metals with polyatomic ions to create commonly known compounds, such as baking soda. The chemical name for baking soda is sodium bicarbonate, so we can combine Na (sodium) with HCO₃⁻ (bicarbonate) and create sodium bicarbonate: NaHCO₃.

This compound is one magnesium atom bonded to two hydroxide ions.

Hydroxide is the compound between one hydrogen atom and one oxygen atom. The compound overall adopts a negative charge of 1.If we have one hydrogen atom and one oxygen atom, the most electronegative atom is written first in chemical formulas. Therefore, the symbol for Oxygen (O) goes first.Then, write in the hydrogen atom directly after the O symbol: OH.Finally, since we have a negative charge on the ion, we need to play a negative sign as a superscript for the compound. Therefore, this becomes OH⁻.

Now, we need to determine the charge on the Magnesium atom which is determined from the amount of valence electrons the atom has.

On a periodic table, the symbol for Magnesium is Mg and this element has 2 valence electrons. In order to fulfill the Octet Rule, the It is more likely to give up 2 electrons to a nonmetal than it is to gain 6, so we can safely assume that the charge is ²⁺.We need to use the criss-cross technique to transfer the charges between the element and the ion, so the negative 1 charge goes to the Mg, which does not appear (negative 1 or positive 1 are implied) and since the magnesium has a charge of positive 2, this is the subscript for the hydroxide ion.Therefore, our compound becomes Mg(OH)₂, and we have labeled this as magnesium hydroxide.

Now, to the number of atoms:

The new charge on Mg is 1-, so there is only one atom of Mg.The charge is 2+ on the OH ion, so there are two atoms of H and two atoms of O.Two atoms of oxygen, two atoms of hydrogen, and one atom of magnesium add up to be five atoms in total.

At about what temperature does the sample change phase? Justify your
answer based on the cooling curve shown above.
A student states, “When the alcohol sample was at a temperature of 500 K, all the particles were moving faster than any of the particles were moving at
400 K" Do you agree or disagree with this student's statement? Justify your
answer.

Answers

Money cuzzo it to crazy

HELP!!! ASAP!!!! WILL MARK BRAINLIEST!!!!






A certain covalent compound contains sulfur bonded to chlorine. Which of the following statements about this compound is correct?
Question 5 options:

A)

Electrons will reside closer to sulfur, and the bond will be non-polar.

B)

Electrons will reside closer to sulfur, and the bond will be polar.

C)

Electrons will reside closer to chlorine, and the bond will be polar.

D)

Electrons will reside closer to chlorine, and the bond will be non-polar.

Answers

Answer:

C) Electrons will reside closer to chlorine, and the bond will be polar

Explanation:

Electrons tend to be closer or attracted to high electronegativity and sulfur has less electronegativity than chlorine. Therefore, electrons will reside closer to chlorine. To find out if it is polar or nonpolar, according to the electronegativity chart you can find online, you can see that the electronegativity of sulfur is 2.5 while the electronegativity of chlorine is 3.0. Because the difference between these two is a slight change, it would be slightly polar. So, the bond will be polar.

Answer:

Electrons will reside closer to chlorine, and the bond will be polar.

Explanation:

Carbon Monoxide is a toxic gas that is colorless and tasteless. How many moles of CO are in 1 L of the gas at STP?

28 moles

0.045 moles

22.4 moles

0.224 moles

Answers

Answer:

0.045 moles

Explanation:

Given data:

Moles of CO = ?

Volume of gas = 1 L

Temperature and pressure = standard

Solution:

The given problem will be solve by using general gas equation,

PV = nRT

P= Pressure

V = volume

n = number of moles

R = general gas constant = 0.0821 atm.L/ mol.K  

T = temperature in kelvin

n = PV/RT

n = 1 atm× 1L / 0.0821 atm.L/mol.K × 273 K

n = 1 atm.L / 22.41 atm.L/mol

n = 0.045 mol

2C3H7OH + 9O2 --> 6CO2 + 8H2O

Determine the number of grams of CO2 produced from the reaction of 5.55 moles of C3H7OH?

a
1466 g

b
16.7 g

c
367 g

d
12.2 g

e
733 g

Please show work

Answers

Answer 12.2g is the answer

Why do molecules change the speed? (SELECT ONE)

 Claim 1: Molecules speed up when energy is created and slow down when energy is destroyed.

 Claim 2: Molecules speed up when they get energy from other molecules and slow down when they give energy to other molecules.

Answers

Answer:

Molecules speed up when they get energy from other molecules and slow down when they give energy to other molecules.

Explanation:

We know from the first law of thermodynamics that energy can not be created nor destroyed.

However, according to the kinetic molecular theory, molecules collide frequently with each other. All molecules in a substance do not possess equal energy hence some molecules are more energetic than others.

When a more energetic molecule collides with a less energetic molecule, the more energetic molecule transfers energy to the less energetic molecule. The less energetic molecule speeds up while the molecule that collided with it slows down due to energy transfer from one molecule to another.

PLEASE HELP I'M BEING TIMED!! Which type of star system has the most stars?
A. Open Cluster
B. globular cluster
C. Eclipsing binary
D. binary star system ​

Answers

Answer:

Hi! It's B - globular cluster

Answer:

B Globular Cluster

Explanation:

Sorry if I am wrong :)

Which of the following equations represents the balanced equation for the reaction of iron and oxygen?

a)
4Fe + 3O2 → 2Fe2O3

b)
2Fe + O2 → Fe2O3

c)
3Fe + 3O2 → 2Fe2O3

d)
Fe + 3O2 → Fe2O3

Answers

Answer:

D is balanced. :)

Among the following equations the one that represents the balanced equation for the reaction of iron and oxygen is a.

4Fe + 3O₂ → 2Fe₂O₃

What is balancing of a reaction?

Balancing of a reaction is done according to the "Law of conservation of mass" and balancing helps in solving stoichiometry questions correctly as if we will not balance the reaction then the quantitative results in a particular question doesn't come correctly.

Balancing of a reaction helps in mole concept as well and it is one of the laws of chemical reactions as well.

Some examples of balanced chemical reactions are-

2Mg(s) + O₂(g) ⟶ 2MgO(g)

Ca(OH)₂ + H₃PO₄ → Ca₃(PO₄)₂ + H₂O

Therefore, Among the following equations the one that represents the balanced equation for the reaction of iron and oxygen is a.

4Fe + 3O₂ → 2Fe₂O₃

Learn more about Balancing of a reaction here:

https://brainly.com/question/14280002

#SPJ2

Although the order of elements is based on atomic number, vertical families share similar chemical properties.

Question 12 options:
True
False WHAT IS IT

Answers

Answer:

It's true

Explanation:

Uhhh, the internet! lol.

Answer:

It's true, ExplanationVVV

Explanation: Because the order of elements is based on atomic number, vertical families share similar chemical properties.

teachers instructions - “ clear my examples and replace with your own words “ you get brainliest if I get good grade :)

Answers

Answer:

can you give me more clearence on what is going on

Explanation:

Density can be calculated by dividing an object's mass by its volume. If the mass of an object is 10 grams and its volume is 2 milliliters, what is its density?

Answers

Explanation:

mass =10g. volume=2ml. density=mass/volume = 10/2=5kg/m^3

Answer:

5 g/mL

Explanation:

So, if the mass is 10 g and the volume is 2 mL, the density equals...

10 g ÷ 2 mL = 5 g/mL

Automobile catalytic converters use a platinum catalyst to reduce air pollution by changing emissions such as carbon monoxide, CO(g), into carbon dioxide, CO2(g). The uncatalyzed reaction is represented by the balanced equation below.2CO(g) O2(g) 2CO2(g) +heat. determine the mass of O2(g) required to completely react with 784g moles of CO(g) during this reaction.

Answers

Answer: 448 g of [tex]O_2[/tex] will be required to completely react with 784g moles of CO(g) during this reaction.

Explanation:

To calculate the moles :

[tex]\text{Moles of solute}=\frac{\text{given mass}}{\text{Molar Mass}}[/tex]    

[tex]\text{Moles of} CO=\frac{784g}{28g/mol}=28moles[/tex]

The balanced chemical equation is:

[tex]2CO(g)+O_2(g)\rightarrow 2CO_2(g)[/tex]  

According to stoichiometry :

2 moles of [tex]CO[/tex] require  = 1 mole of [tex]O_2[/tex]

Thus 28 moles of [tex]CO[/tex] will require=[tex]\frac{1}{2}\times 28=14moles[/tex]  of [tex]O_2[/tex]

Mass of [tex]O_2=moles\times {\text {Molar mass}}=14moles\times 32g/mol=448g[/tex]

Thus 448g of [tex]O_2[/tex] will be required to completely react with 784g moles of CO(g) during this reaction.

Answer:

Boy I'm really boutta get to yo pickle chin ahh boy, egg head like collard greens head a//ss boy, oh hell nah boy yo dirt ahh boy stank ahh boy afro head ahh, lip gloss chin ahh boy ugly ahh boi

Explanation:

Worth 20 points will mark you brainliest!

Answers

The one u clicked is the the right one

If it takes 5 hours to produce 8.0 kg of alcohol, how any days will it take to consume 1000 kg of glucose?

Answers

It takes 21.3 days

Further explanation

Given

5 hr = 8 kg Alcohol

Required

Days to consume 1000 kg of glucose

Solution

Alcoholic fermentation⇒ glucose produces ethanol and carbon dioxide,

C₆H₁₂O₆ → 2 C₂H₅OH + 2CO₂

mol ethanol :

[tex]\tt \dfrac{5000~g}{46~g/mol}=108.7~moles[/tex]

moles of glucose to produce 108.7 moles ethanol :

[tex]\tt \dfrac{1}{2}\times 108.7=54.35[/tex]

54.35 moles = 5 hours

moles of 1000 kg of glucose :

[tex]\tt \dfrac{10^6~g}{180~g/mol}=5555.5~moles[/tex]

So for 5555.5 moles, it takes :

[tex]\tt \dfrac{5555.5}{54.35}\times 5~hours=511.085~h=21.3~days[/tex]

If you discover a new element, how would you know where it should go on the periodic table

Answers

Answer:

the atomic number

Explanation:

it would be in the upper corner

State and explain each law of motion.

Answers

Answer:In the first law, an object will not change its motion unless a force acts on it. In the second law, the force on an object is equal to its mass times its acceleration. In the third law, when two objects interact, they apply forces to each other of equal magnitude and opposite direction

Explanation:

Answer:

EEEEEeeEEeEEEEEEEeEEEEEEEEEE

Explanation:

e

Describe the subatomic particles found in an atom, and
describe each one. Also, describe how they relate to each
other.




pls helpp <3

Answers

Hehehehe jekejeihdneje idiejejud jewel

PLEEEASSEEEE HELPPPPP!!!!!Take some time to research a utility plant. If there is one in your area, you may even visit it.
Otherwise, look up a type of plant that produces energy - such as a nuclear power plant, a
hydroelectric plant, or a coal-burning plant. Find out what energy resources are brought into the
plant. Then find out what energy and what "waste" is produced by the plant. Describe how the
two Laws of Thermodynamics apply to what you find out in your research. Be thorough. You will
be using the information you gather to engage in a debate with your class about
thermodynamics.

Answers

Answer:

There are four laws of thermodynamics that define fundamental physical quantities (temperature, energy, and entropy) and that characterize thermodynamic systems at thermal equilibrium.

Explanation:

Write the ionic equation, including state symbols, for the reaction between zinc and iron(II) sulfate

Answers

Answer:

Fe (s) + Cu^2+ (aq) + SO4^2- (aq) --> Cu (s) + Fe^2+ (aq) + SO4^2- (aq)

Explanation:

Other Questions
Where is Europe located in relation to the United States? What about the location of New York state makes it a good location for trade between the United States and Europe? Answer please I need this quick !!!! At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost? what does hi mean in spanish How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) What is the definition of fourteen points? What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please!