What is the percent of decrease from 100 to 38?

Answers

Answer 1

Answer: 62

Step-by-step explanation:

100 - x = 38

x =62


Related Questions

Given f(x) = -x+ 6 and g(x) = f(x + 3), write an equation for function g.
plz help

Answers

Answer:

equation of g(x) is 3-x

f(x)= -x+6 g(x)=f(x+3)

then,,

f(x+3)=-(x+3)+6 =-x-3+6 = 3-x

ie.. g(x)=3-x

Tria had one each of five different-shaped number solids having 4, 6, 8, 12, and 20 sides. She rolled two at a time and found probabilities for the sum of the numbers that came up. She recorded the probabilities in the first column of the table. When it came time to fill in the second column, she had forgotten which number solids she had used. Figure out which number solids she must have used and explain your thinking. The first one has been done.
She found out that the probability of 4 is lesser than 5, which combinations did she use?

Answers

Answer:The probability of a 3 is 2/80 or 1/40

The probability of a 4 is less than the probability of a 5

Step-by-step explanation:

identify the transformation performed on the figure below

Answers

A) Translation

hope this helps!

Answer:

translation

Step-by-step explanation:

this is a translation because every point of the shape remain in the same position as it is moved.

Simon walks a total of 45.55 miles in march sand 35.7 miles in April.


How many miles does Simon walk in all march and April?

Enter your answer in the box.


|__|

Answers

Answer:

[tex]81.25[/tex]

[tex]45.55 + 35.7[/tex]

Find 3 other points for this equation for both x and y ( bots don’t answer pls )

Answers

Answers:

Row one:  x = -10 and y = -4Row two:  x = 0 and y = 6Row three: x = 2 and y = 8

There are infinitely many other possible answers.

===================================================

Explanation:

The [tex]\frac{3}{3}[/tex] simplifies to 1. Dividing any nonzero number over itself always leads to 1.

So the equation [tex]y = \frac{3}{3}x+6[/tex] simplifies to [tex]y = x+6[/tex]

To determine y, we add 6 to x.

Pick 3 random values you want for x.

Let's say we picked x = 0

y = x+6

y = 0+6

y = 6

So x = 0 leads to y = 6

-----------

If you tried something like x = 2, then,

y = x+6

y = 2+6

y = 8

So (2,8) is another point on the line

-----------

Lastly, let's try a negative number. Let's go for x = -10

y = x+6

y = -10+6

y = -4

The input x = -10 gives the output y = -4

There isn't any restriction on x, so you can use any number you want. Therefore, there are infinitely many possible answers.

A certain amount of money is divided among Rio, Kim and Leo in the ratio 5:7:3. If Leo gets Php 24,000.00, how much is the total amount?​

Answers

Answer:

120,000

Step-by-step explanation:

Let's say Rio gets 5x, Kim gets 7x, and Leo gets 3x. In the ratio 5:7:3:1, x = 1

5x + 7x + 3x = total = 15x

3x = 24000

divide both sides by 3 to get x

x = 8000

15x = 8000*15 = 120000

Can you help? Please show work. Thank You.

Answers

Answer:

  C.  x+y=5; -2x+y=2

Step-by-step explanation:

The slope of the line in Table A is ...

  m = (y2 -y1)/(x2 -x1)

  m = (-6 -(-4))/(11 -9) = -2/2 = -1

The slope of the line in Table B is ...

  m = (-8 -20)/(-5 -9) = -28/-14 = 2

We observe that the slopes have different signs. This means the signs of the terms in the standard form equation will be different from one equation to the other. The only pair of equations for which that is true is the pair in choice C.

Trying these equations on the first line of the tables, we see they match the table values.

  Table A: 9 +(-4) = 5 . . . true

  Table B: -2(9) +20 = 2 . . . true

_____

Additional comment

Neither equation in choice A has the correct slope for either table. The equations in choice B are inconsistent, both having slope -1, but different y-intercepts.

Answer this .i will make you brainliest

Answers

[tex]\huge{\underline{\underline{\boxed{\sf{\purple{ǫᴜᴇsᴛɪᴏɴ}}}}}}[/tex]

(8) An aeroplane takes off from Dubai located in the +4 time zone at 13:00. It arrives in Manila in Philippines, located in the +8 time zone at 20:00.

(1) Find the time in Manila when the aeroplane departsfrom Dubai.

(ii) Find the time duration of the flight.

(iii) What is the time in Dubai when the aeroplane arrives in Manila?

[tex]\huge{\underline{\underline{\boxed{\sf{\ref{Answer}}}}}}[/tex]

(i)17.00(ii)3 hours(iii) 16.00

[tex]\large\huge\green{\sf{♥ Explanation♥}}[/tex]

Dubai located +4 zone, takes off at 13.00,

∴Hence, at standard it is 13.00-4 =99.00 STD talk

off reached at Manila +8 Zone at 20.00

∴Hence at standard & 2000 -8

reached.⇒ 12.00 STD

Hence time of flight was = 3 hours.

(i) Time at Manila, whicle Plane de parts

12-3+8 ⇒9+8 → 17.00

(ii) duration = 3 hours.

(iii) in dubai 13.00 + 3 = 16,00

_____________________

Ans

i)17.0.0 (ii) 3 hours (iii) 16.00

________________________

♕ hence we done:) xD

Find the 12th term of the geometric sequence.
15, 30, 60, ...

Answers

⇒ common ratio =r=3 and the given sequence is geometric sequence. Where an is the nth term, a is the first term and n is the number of terms. ⇒ 12th term is 708588 . ⇒Sum=1062880 .

Answer:

465

Step-by-step explanation:

The way I thought about it was I subtracted 30 from 15 and got 15. Then I subtracted 60 from 30 and got 20. My conclusion is you continue to add 5 more to what you added before. 15, 30, 60, 85, 115, 150, 190, 235, 285, 340, 400, 465.

The military academy is placing cadets in rows for the parade. All rows must have the same number of cadets. If A company has 64 cadets and B company has 80 cadets, what is the greatest number of cadets who can be in each row?

Answers

Answer:

72

Step-by-step explanation:

If we find the average for both companies, it is 72, therefore there are two rows each with 72 cadets

Answer:

the answer is 16 please make me brainliest :> thx uuu

Hi. Can someone pls help

Answers

(2,10) this is because 7 x 2 is 14, minus 4 that’s 10

Answer:

(2, 10)

Step-by-step explanation:

If you graph the line and all 3 points, you can tell that only (2, 10) lies on the point, therefore, it would make the equation true. You can also figure it out algebraically.

[tex]10 = 7(2) - 4\\\rule{150}{0.5}\\10 = 14 - 4\\\\\boxed{10=10}[/tex]

Hope this helps.

Help! Help! HELP!!
Find the value for x

Answers

Answer:

21

Step-by-step explanation:

5(21)-12=93

3(21)+30=93

Given that
f
(
x
)
=
4
x

2
and
g
(
x
)
=
2
x
, evaluate
g
(
f
(
5
)
)

Answers

Answer:

36

Step-by-step explanation:

compare:
1. 4 3/8 (__) 4 7/10
2. 3/10 (__) 25/100
3. 5/8 (__) 3/5
4. 8/12 (__) 6/9
Help me please, and thx for the help

Answers

1. > 7/10 = 70% and is more than 3/8.
2.> 3/10 is equal to 30% which is more than 25%
3. > 5/8 is equal to 25/40 and 3/5 is equal to 24/40
4. = 8/12 is equal to 72/108 and 6/7 is equal to 72/ 108 too

1) 4 3/8 < 4 7/10

2) 3/10 > 25/100

3) 5/8 > 3/5

4) 8/12 = 6/9

hope this is helpful!

HELPPPPPPPPPPP Asapp

Answers

Answer:

B. Kilograms

Step-by-step explanation:

Kilograms is what is measured for sugar. B

Yolonda ran 4 times last week here are the distances she ran in km
17.9,6.03,15.66,3
What’s the total distance ran

Answers

Answer:

42.59 km

Step-by-step explanation:

Total distance = 17.9 + 6.03 + 15.66 + 3 = 42.59

Answer:

42.59 km

Step-by-step explanation:

When a question tells you to find the total of something it is usually means you need to add to add decimals you align the decimals and if a number doesn't have a decimal you add .0 on the end then line it up. It also might help to add a 0 in empty spots . Then you move the decimal to the same place in the solution and add like normal.

     

 17.90

 06.03

  15.66

+03.00

 42.59

Help me plz
A)12.7
B)13.3
C)12.4

Answers

Answer:

A.

Step-by-step explanation:

Felipe swam 29 kilometers to an island. Then he swam 19 kilometers to a boat. How far did he swim in all?

Answers

48 kilometers

29 + 19 = 48

hope this is helpful!

29+19=48 in all! (Add how much he swam each way)

Which numbers make a true statement when placed in the box?

8.274< |__|


Select EACH correct answer.


1) 8.199

2) 8.201

3) 8.396

4) 8.295


*Disclaimer*

Show work!

Answers

Answer:

3 & 4

Step-by-step explanation:

Because 3 = 8.396 which is greater than 8.274 also the same with 4 which is 8.295

need help asap plz help me

Answers

Answer:

idek not gonna lie

Step-by-step explanation:

Answer:

The first one is A) 4 The second on is D) 65

Step-by-step explanation:

You divide the first number by the second number eg. 12 divided by 3=4. so 4.

You repeat the process for the second one, which is 32.5 divided by 5=6.5 so then you multiply that times 100 so 65.

The area of a rectangle is given by 3x^3+14x^2-23x+6
The width of the rectangle is given by x + 6. Find an expression for the length of the rectangle.

Answers

The length of the rectangle is defined by [tex](x-1)\cdot \left(x-\frac{1}{3} \right)[/tex].

Geometrically speaking, the rectangle area is equal to the product of its base and its length. According to the statement the area is represented by a third order polynomial and width by a first order polynomial and, thus, length must be a second order polynomial.

By factor the polynomial we get the following roots:

[tex]A = 3\cdot x^{3}+14\cdot x^{2}-23\cdot x + 6[/tex]

[tex]A = (x+6)\cdot (x-1)\cdot \left(x-\frac{1}{3} \right)[/tex]

Then, the length of the rectangle is defined by [tex](x-1)\cdot \left(x-\frac{1}{3} \right)[/tex].

To learn more on rectangles, we kindly invite to check this verified question: https://brainly.com/question/10046743

Let a and b stand for two different rational numbers. If |a|>|b|, then what else must be true?

its for imagine math

Answers

Answer:

dont now

Step-by-step explanation:

60.98 x 62xv Whats v

Answers

V=13 because you minus 60.98 by 62

HELP PLEASE!!!A 2-column table with 5 rows. Column 1 has entries 25 percent, 25 percent, 25 percent, 25 percent, Total 100 percent. Column 2 has entries 12 dollars, 12 dollars, 12 dollars, 12 dollars, Total 48 dollars.
Which of the following scenarios could be accurately modeled using this diagram?
Juan Victor gave a gratuity of $25 on a bill that was $48.
Juan Victor gave a 25% gratuity of $12 on a bill that was $48.
Juan Victor gave a gratuity of $12 on a bill that was $100.
Juan Victor gave a 12% gratuity on a bill that was $25.

Answers

B) Juan Victor gave a 25% gratuity of $12 on a bill that was $48.

hope this is helpful!

This is a Function?


O True
O False

Answers

Answer:

true

Step-by-step explanation:

I NEED HELP PLEASE!!!!

Perform integer operations
1 2/3(1 + 1/4) ÷ 1/4

Answers

Answer:

8.33 is keeps repeating

Step-by-step explanation:

can you guys help me?​

Answers

Answer:

Step-by-step explanation:

1. y = 2x

       y = 2*4 = 8  Checks, therefore

y = 20  for x = 10

2. y = 3x

       y = 3*(0.3) = 0.9  Checks, therefore:

y =  3*(1.5) = 4.5  

       y = 3*

3. y = 5/x

       y = 5/(1/2) = 10  Checks, therefore:

       3 = 5/x

x = 5/3

4 v = wu

7*3 = 21  Checks, therefore:

v =  (3/4)*(6) = (18/4) = (9/2)

v = (2/3)wu

v = (2/3)*7*3 = 14 Checks

5 m = Kn/p  [Add the K as a constant that will make m = Knp true at some value of K]

9 = K*2/(1/3)

27 = (K*2)

27 = 2K

K = (3/2)

       m = (3/2) (n/p)

       m = (3/2)*((1/2)/(1/3))

        m = (3/2)*(3/2)

        m = 1

   

Ryan earned badges at Camp Evergreen for completing different activities. He earned 7 outdoor activity badges for every 3 indoor activity badges.
If Ryan earned 6 indoor activity badges, how many badges did he earn in all?

Answers

Answer:

20 badges

Step-by-step explanation:

3×2=6 (indoor activities)

7×2=14 (outdoor activities)

6+14=20

8. Jordan has $11.40 to spend at the used book store. Each book costs $280. How many books can Jordan buy?​

Answers

Answer:

0

Step-by-step explanation:

Jordan hasn't got enough money to buy any books, as $11.40<$280.

He can buy 4 books
11.40/2.85 = 4

please help anybody hm​

Answers

Answer:

The answer is 1

Step-by-step explanation:

The answer is 1

The reason that it’s one and not zero is because your multiplying the number by itself 0 times and that means you’re not multiplying by anything at all.
Other Questions
during a science lab, Carina measured the mass of an object to be 23.4 grams. the actual mass turned out to be 22.5 grams. What was the percent error in Carina's measurement? The computer monitor to the right has a length of 44 inches anda width of 38 inches. Find the length of the diagonal. Round youranswer to the nearest hundredth. The police___ that the children died in an accidenta. believes c. believeb. is to believe d. are believing Gravitational force acts on all object in proportion to their masses. Why then, a heavy object does not fall faster than a light object? Eleventh gradeX.1 Identify and correct errors with subject-verb agreement 08SYou have book covers to reveal! Co toFind the error with subject-verb agreement. Select the incorrect verb and type it correctiy.The metric system, first created by French scientists in the 1790s, isbased on a unit of length known as the meter. Approximately 3.28 feetare the equivalent of one meter,This is for English !!! Blair worked for 4 2/5 hours and earned $36.30. How much would she earn if she worked for 5 4/5 hours? Enter your answer in the box.PLEASE HELP ASAPPPPP!!! I WILL GIVE BRAINLIEST AND 50 POINTS!!! PLEASE HELP!You are camping and have only a 3 cup container and a 5 cup container. You need to measure 1 cup of water into a pot. How can you do this? Is there more than one way? Explain. How does Equiano's fear of being eaten by slavers serve as a metaphor for slavery itself ? 12 for every 2 male birds in a bird cage there are 5 females. What is the ratio of the males to females 2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data