Answer:
Excretion and Nutrition.
Explanation:
Hope this helped :)
Answer:
Explanation:
MRS GREEN is acronym to help remember the features of all living organism the main ones are : Movement, Respiration, Sensitivity, Growth, Reproduction, Excretion and Nutrition.
So Excretion and Nutrition is the missing part to the passage.
Hope this helps!
What are common changes
In an environment?
Answer:shelter, land, prey
Explanation:
centricles play specific roles during the division of
Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them
Explanation:
1. what is an organelle?
2. give me an example of an organelle.
3. Which organelle is the "command center" of
the center?
Answer:
1. a subcellular structure that has a job to do within the cell
2. mitochondria
3. the nucleus
Genetic engineering involves _______ to achieve desired results. a. enzyme production b. modifying products and processes c. changing one organism into another d. introducing traits into organisms Please select the best answer from the choices provided A B C D
Answer:
D
Explanation:
the answer is d bruv like fr
Answer:
D
Explanation:
DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD
The movement of water in or out of the cell membrane without the use of ATP.
Diffusion
Facilitated diffusion
Osmosis
Excoytosis
what occurs in a chemical reaction
Answer:
options on. D is write answer
Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function
Answer:
all cells contain nuclei.
Explanation:
prokaryotes dont have a nuclei
Describe how the circulatory system allows the endocrine system to do its job?
Answer:
The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.
5 tips to improve your critical thinking - Samantha Agoos
Watch the Video and make a summary
Ps: They don't let me paste the link lookup what it says above
Answer:
that one is hard because we did not see the vidoe
Explanation:
what is a cell membrane?
Answer:
The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.
Explanation:
Answer:
Short. The semipermeable membrane surrounding the cytoplasm of a cell.
Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.
Explanation:
I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)
In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.
Answer:
Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.
I tried my hardest and this is what I put on MY test so good luck
describe and explain how the rate of photosynthesis is affected by light intensity
What three things regarding cell organelles are different between plant and animal cells?
Answer:
Plant cells have a cell wall, but animals cells do not. ...
Plant cells have chloroplasts, but animal cells do not. ...
Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present
Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system
Answer:
a. Capillary action of liquid in plant stems
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system
Explanation:
Hope this helped!
In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.
What is Adhesion?Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.
In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.
Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.
Learn more about adhesion on:
https://brainly.com/question/14457491
#SPJ2
Which is an example of the use of plants in human societs?
Answer:
|
v
Explanation:
photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.
which of the following is not true about an allele?
A. alleles are found at the same place on a chromosome
B. alleles have a dominant and recessive form
C. an allele is never independently assorted and passed down randomly
D. and allele is one of two or more forms of a gene
Answer:
C
Explanation:
I guess it's C but not conform
C. An allele is never independently assorted and passed down randomly.
What is an allele?Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.
However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.
Learn more about allele, here:
https://brainly.com/question/14206531
#SPJ2
What do RNAs do in the cell?
Group of answer choices
Answer:
A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.
Explanation:
None
can u answer that question
Answer:
The synthesis of new proteins
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond
Answer:
A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.
Explanation:
Answer:
saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length
hope it helps
Explanation:
Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore
Answer:
Decomposer
Explanation:
Decomposers eat dead organsims carnivores rarely
Answer:
C. Decomposer
Explanation:
A.P.E.X
Which of these are true of physical therapists? Check all of the boxes that apply.
All physical therapists can diagnose.
Physical therapists strengthen muscle and improve balance.
Physical therapists do not prescribe medication.
Physical therapists are considered doctors.
Physical therapists are commonly called physiatrists.
4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases
Answer:
The answer is A
Explanation:
am 100% sure
plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion
A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant. Which statement provides evidence to support the student’s inference?
Answer:
A. The water pressure in the plant's vacuole is low, and without water, the chloroplasts cannot convert carbon dioxide to glucose during photosynthesis.
Explanation:
Photosynthesis occurs on chloroplasts which are located on the surface of leaves. Photosynthesis is the conversion of carbon dioxide, water, and light energy to produce glucose and oxygen for plants.
The vacuoles inside the plant's cell contain stored food and absorb water through osmosis. Water in the vacuole has more solutes than water outside the vacuole. This causes the Turgor Pressure which the vacuole impacts on the plants. If the reverse becomes the case, water is lost from the vacuole causing it to shrink.
Flaccidity of the vacuole and the cell wall will cause the chloroplasts where photosynthesis occurs to shrink.
I could really use some help on this question l, please help!?! Thank you ❤️ much love stay safe 2020
Answer: its B and D
Explanation:
What are two ways in which cells use the energy temporarily stored in ATP?
Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways
The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.
What is Active transport?
Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.
ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.
Learn more about ATP here:
https://brainly.com/question/14637256
#SPJ2
1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False
Answer:
False.
Explanation:
Peer review provide others scientist in the field to assess a scientist's investigations and results.
Peer Review:
It is the reviewing or evolution of the work by many professionals and experts in the field.
For example- A scienfic manuscript is send to the many scientist for evolution before publication.
This peer review is unbiased because the reviewer does not know the name or other information about writter.
To know more about Peer Review:
https://brainly.com/question/10853815
Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another
answer: yes
exanation:
6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia
Answer:
Desert mole excretes concentrated urine with urea.
Marine fish excretes urine with uric acid.
Tilapia excretes dilute urine with amino acids.
Explanation:
The nitrogenous wastes that are excreted by the following organisms are as follows:
Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids. What is Nitrogenous waste?Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.
Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.
While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.
Therefore, it is well described above.
To learn more about Nitrogenous waste, refer to the link:
https://brainly.com/question/9517408
#SPJ2