Answer:
An invasive species is an organism that causes ecological or economic harm in a new environment where it is not native.
Explanation:
Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. An invasive species can be introduced to a new area via the ballast water of oceangoing ships, intentional and accidental releases of aquaculture species, aquarium specimens or bait, and other means.
Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats. This can result in huge economic impacts and fundamental disruptions of coastal and Great Lakes ecosystems.
Mill proposes that "higher" pleasures are those preferred by the majority of people. Do you agree that this is a good way of distinguishing between higher and lower pleasures? Can a well-informed majority prefer higher pleasures?
Higher pleasure is a pleasure that would be chose by a greater number in the population.
What is higher pleasure?The term higher pleasure is a pleasure that would be chose by a greater number in the population even when it involves some level of discomfort. This opposed to the lower pleasures which could be traded for the higher pleasures.
I agree with Mill's proposal regarding higher pleasures. For instance people will always prioritize the pleasure of learning things which is a higher pleasure to other pleasures.
What is higher pleasure: https://brainly.com/question/22406307
A divergent boundary at two oceanic plates can result in a
-mid-ocean ridge
-volcanic island arc
-continental volcanic arc
-subduction zone
If the side of a cubical cell doubled, what would the cell then require? Select all the correct answers.
A. eight times more nutrients
B. to excrete eight times more waste
C. four times more nutrients
D. to excrete four times more waste
Given what we know, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.
Why would the cell require more nutrients?This has to do with the ratio between surface area and volume. Since volume is squared when calculating it, the volume of a cell increases much more rapidly than that of its surface area. So a cell that doubles in size would quadruple in volume, needed four times as many nutrients to maintain its internal processes.
Therefore, we can confirm that a cell that doubles in size would then require four times more nutrients, option C is correct.
To learn more about cells visit:
https://brainly.com/question/5763151?referrer=searchResults
Penelope is adding fractions while taking a math test. What part of her brain is at work?
spinal cord
cerebrum
cerebellum
hypothalamus
Answer:
Cerebrum
Explanation:
The cerebrum is the part of the brain that includes the hippocampus, which is responsible for solving math problems.
Answer:
cerebrum
Explanation:
edge 2022
Which one of the following is the softest?
(A) Aluminium
(B) Iron
(C) Lithium
(D) Sodium
Answer:
Sodium
Explanation:
Sodium is the softest and 2nd most reactive element/metal after potassium.Represented as Natrum(Na)You can cut this with regular knifes even .Which behavior is a response that is determined by heredity?
O fighting for protection
O All behaviors are determined by heredity.
O hunting in packs
O sleeping
Which behavior is a response that is determined by heredity?
Answer:
D. Sleeping
D.) sleeping
Behavioral responses such as sleep has been found to be hereditary or affected by your genes.
[tex]#Keeplearning [/tex]
A student is designing a device for humans to communicate through detectable light. Which waves should the student use from the electromagnetic spectrum? A X-ray waves B visible waves C infrared waves D ultraviolet waves
A.it should be a x-ray waves
A crossover in meiosis is an exchange of genetic material between
A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes.
2.
A tetrad is made up of
A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids.
3.
Which of the following statements about crossing over is TRUE?
A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above
4.
Crossing-over occurs during prophase I of meiosis.
A) True
B) False
5.
Crossing-over allows the reassortment of linked genes.
A) True
B) False
A crossover in meiosis is an exchange of genetic material between
A) sister chromatids of the same chromosome.
B) sister chromatids of homologous chromosomes.
C) sister chromatids of non-homologous chromosomes.
D) non-sister chromatids of homologous chromosomes.
E) non-sister chromatids of non-homologous chromosomes. ✓
During meiosis, the two chromosomes in each parent,swipe their place resulting in a hybrid new genetic material2.A tetrad is made up of
A) four non-homologous chromosomes.
B) four non-homologous chromatids.
C) four homologous pairs of chromosomes.
D) two homologous pairs of chromosomes.
E) two homologous chromosomes, each consisting of two chromatids. ✓
Tetrad is a group of four chromatids formed in pachytene stage of meiosis3. Which of the following statements about crossing over is TRUE?
A) It occurs only in males.
B) It occurs only in some chromosomes.
C) It occurs only between genes that are heterozygous.
D) It results in reduced genetic variation among gametes.
E) None of the above ✓
The process of crossing over takes place between homologous chromosomes to increase genetic diversity4.Crossing-over occurs during prophase I of meiosis.
A) True ✓
B) False
crossing over helps in genetic variation and occurrs between prophase 1 & metaphase 15. Crossing-over allows the reassortment of linked genes.
A) True ✓
B) False
Crossing over helps in the reassortment of non-sister chromatids of non-homologous chromosomesCrossing over may be defined as the process through which the exchange of genetic material between homologous chromosomes takes place that results in the mixture of parental characteristics in the offspring.
According to the context of this question, the process of crossing over takes place during the Pachytene stage of meiosis which significantly involves the reassortment of linked genes.
Therefore, each of the given questions is well answered above.
To learn more about Crossing over, refer to the link:
https://brainly.com/question/927405
#SPJ2
Which environmental change would most likely result in bullfrog offspring that are able to store more water than bullfrogs in previous generations?
A.
a dry season that lasts for a month
B.
flooding that turns the valley into a lake
C.
a drought that lasts for a very long time
D.
a rainy season that lasts for a month
Answer:
C.
a drought that lasts for a very long time
Which of the following is the strongest conclusion to an informative essay about Sherlock Holmes's strongest character traits as a detective?
A. In conclusion, Sherlock Holmes's drive to find answers and his observation skills led to his success as a detective. Plenty of readers admired this detective and went on to become detectives, too. While none were as famous as Holmes, many joined him in saying, "It's elementary, Watson!"
B. In summary, Sherlock Holmes was determined to find answers, no matter what.
He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.
C. To conclude, Sherlock Holmes became a detective so that he could use his character traits for good. He searched for answers in The Mystery of the Lost Gem, even when Mrs. Blakely doubted him. Sherlock's drive to find answers was rewarded at last.
D. To summarize, Sherlock Holmes's character traits led to his success as a detective. Many readers admired this detective and tried to imitate him, even going so far as to say, "It's elementary, Watson!"
The strongest conclusion to this informative essay about Sherlock Holmes is: B. In summary, Sherlock Holmes was determined to find answers, no matter what. He used his five senses to observe people and objects around him. These skills led to him becoming a great detective.
What is an informative essay?An informative essay can be defined as a literary work that presents factual information about an event, people, places or things.
This ultimately implies that, the main purpose of an informative essay is to provide sufficient information and explanation about an event, object, person (individual), places, or phenomenon to the readers (audience).
In this context, Sherlock Holmes's strongest character traits such as his five senses, as a detective should be highlighted or presented to the readers (audience).
Read more on informative essay here: https://brainly.com/question/19949636
True or False? A forest of conifers holds more living matter than tropical rainforests.
A. True
B. False
Answer:
true
Explanation:
The statement "a forest of conifers holds more living matter than tropical rainforests" is definitely true.
How do coniferous forests differ from tropical rainforests?Tropical Rainforests undergrowth is evenly distributed. Not much plant growth as very little sunlight passes through the canopy and reaches the forest floor, But coniferous has little undergrowth due to the low amount of sunlight received and the low soil nutrient.
The tropical rainforests have higher and large heights of trees and other vegetation. Due to this, other living matter must definitely be inhibited due to the absence of sunlight.
While in conifers, the height of trees and other vegetation is shortly limited, due to which other living matter also receive a high amount o sunlight. As a result of this, they grow and reproduce successfully.
To learn more about Tropical rainforests, refer to the link:
https://brainly.com/question/1146251
#SPJ2
Name the chemical that helps in providing the ideal pH for pancreatic amylase to function in the human body.*
Answer:
What is the chemical that helps in providing the ideal PH for pancreatic amylase to function in the human body?
Explanation:
This allows the protein lipase to break down and digest the fat in the small intestine much more quickly. The pancreas secretes bicarbonate to neutralize the acidity of chyme and pancreatic amylase to aid in the digestion of carbohydrates.
Question 9 of 10
Which three plates touch the South American plate?
Answer:
South American plate is bounded by African plate in the east, Nazca plate in the west, Antarctic plate and Scotia plate in the south, and Caribbean plate and North American plate in the north.
Explanation:
An ecosystem is a community of living organisms and the nonliving components of the environment Energy flows in an ecosystem in one direction through food chains, and a food web is made up of all the food chains within a community of organisms. Biodiversity refers to the variation in species found within an ecosystem, and it is measured in two ways: (1)
species richness, which is the total number of different species in an ecosystem; and (2) relative abundance, which is a measure of how common each species is within the ecosystem
Imagine that carnivore D represents the sea lamprey in the Great Lakes ecosystem. This invasive species has been present there
since the 1800's yet the ecosystem has remained stable. How can you explain this?
A) The sea lampreys are indigenous to salt water and have a very short life
span
B) There are complex feeding mechanisms at work to protect the other
species in the food web.
C) The sea lampreys only feed on one type of fish so they have only depleted
that single population.
D) Marine scientists have developed a method to effectively remove the
Lampreys from the Great Lakes.
Answer:
B
Explanation:
there are complex feeding mechanisms at work to protect the other species in the food web
biology The studly of cells is called what
Answer:
Cytology is the study of cells as fundamental units of living things.
What is the mRNA that would be transcribed from this strand of DNA?
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
- Explain the differences in growth between animals and plants
Answer:
The differences are given below
Explanation:
Plants differ from animals in their manner of growth. As young animals mature, all parts of their bodies grow until they reach a genetically determined size for each species. Plant growth, on the other hand, continues throughout the life span of the plant and is restricted to certain meristematic tissue regions only.
Label what each letter means (photosynthesis)
Answer:
A- sunlight B-Oxygen C-carbon dioxide emission
Explanation:
Which of the following would NOT be considered growth and development?
The statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.
What is growth and development?Growth in living organisms refers to the increase in size and number of living cells while development refers to the progressive changes in within an organism.
Growth and development can be exemplified by the following scenarios:
A single cell getting larger before dividingAn egg becoming multiple cellsAn organism going through multiple stages of lifeTherefore, this reveals that statement that would not be considered growth and development is as follows: group of molecules that are attracted together to form a larger sheet.
Learn more about growth and development at: https://brainly.com/question/8347621
HELP!!!
[BWS.05]Where would positively charged particles be most likely found in an atom?
O around the electrons
O inside the electrons
O inside the nucleus
O outside the nucleus
Answer:
inside the nucleus
Explanation:
protons and nuetrons are in the nucleus, electrons are the ones that orbit a nucleus
Which part of the plant carries water and food to and from the leaves? veins leaf blade petiole chloroplast
Veins is the part of the plant that carries water and food to and from the leaves.
Which part carries water in the plant?The xylem distributes water and minerals through the plant i.e. from the roots to the leaves through their vein network while on the other hand, phloem carries food from the leaves to the roots.
So we can conclude that Veins is the part of the plant that carries water and food to and from the leaves.
Learn more about water here: https://brainly.com/question/1313076#
Answer: The veins.
Explanation:
I have many questions for my hw
Here are all the facts:
A girl, lets call her Grace, is wondering which pet she should get. she has owned a betta fish before, and has done a lot of research for hermit crabs. But here are some things she doesn't know:
1. Which one is easier to care for? Betta fish or hermit crab
2. Will a hermit crab be ok in a five 1/2 gallon tank?
3. Is it ok if she just gets one hermit crab or should she get multiple?
4. And ultimately, which one should she get, hermit crab or betta fish?
The last one is the most important. Thanks!
Answer:
1. Betta Fish
2. Yes. Choose a terrarium that has at least 5 gallons of space per 2 crabs.
3. They require companionship! Hermit crabs, despite their name, are social creatures that thrive best in groups of two or more.
4. Both are entertaining, but I prefer betta. Hermit crabs, in my experience, are extremely sensitive and difficult to keep alive. Hermit crabs proved to be much more difficult than I anticipated, but bettas are a little more straightforward. That is just my opinion; I am sure you will do fantastic with whatever you choose.
I hope this helps you
:)
Compare how energy is used worldwide with how it is used in the United States.
Answer:
the U.S comsumes almost 15% of the worlds energy
Explanation:
yes
The objective lenses of the compound light microscope are attached to the
Answer:
C
Explanation:
its C
Answer:
The objective lenses of the compound light microscope are attached to the rotating nosepiece.
Explanation:
How does tsunami occurs? explain its effect
Which of the following describes a step in recycling raw materials to make the same or new items?
I. Use a directory to learn how to recycle a material.
II. Use refillable water bottles.
III. Use up a product completely.
I only
II and III
I and III
I, II, and III
Answer:
I only --- Use a directory to learn how to recycle
Explanation:
Number II and III do not help in recycling raw materials to make same or new (just took test got it right)
Using a directory to learn how to recycle a material is the step in recycling raw materials to make the same or new items. The correct option is A.
What is recycling?Recycling is the process of converting waste materials in to other unique raw materials for the production of innovative products.
A material with high recyclability is one that can be easily recycled, which also means that its material properties need not depreciate significantly compared to those of simple material.
Recycling consists of three steps namely collecting recyclable materials, transforming recycled materials into new products, and selling and purchasing products containing recycled material.
The step in recycling raw materials to make the same or new items is to use a directory to learn how to recycle a material.
Thus, the correct option is A.
For more details regarding recycling, visit:
https://brainly.com/question/11861824
#SPJ5
Which of the following can cause damage to blood vessels if not treated?
hypertension
smoking
obesity
genetics
Answer:
hypertension
Explanation:
because high blood
Answer:
hypertension
Explanation:
High blood pressure is a major risk factor for cardiovascular disease.
when did dinos die? when tell me please
Answer:
65 Million years ago
Explanation:
I looked it up
Answer:
65 million years ago during the Jurassic and Triassic eras, a giant meteor struck what would be earth, and we had to start all over again. Here we are 65 million years later.
I hope this helps! Have a wonderful day.
How many miles away is the moon from earth?
Which of the following would not be found in blood serum? (2 points)
Antibodies
Platelets
Nutrients
Wastes
Answer: The answer is (B) Platelets. You wouldn't find Platelets in blood serum.
Explanation: