what is a function of a protein marcomolecule?​

Answers

Answer 1

Answer:

Proteins are a class of macromolecules.

Explanation:

Proteins are a class of macromolecules, that can perform a diverse range of functions for the cell. They help in metabolism by providing structural support and by acting as enzymes, carriers or as hormones. The building blocks of proteins are amino acids.


Related Questions

True Or False urgebt

Answers

Answer:

The answer is true

Explanation:

true

Replicate the following DNA sequence: CCC

Answers

Answer:

GGG

Explanation:

use AT GC

opposite of C is G and since there's 3 c's you replicate and get 3 g's

Which process is not caused by the movement of Earth's plates?
A ocean island formation
B chemical weathering
C mountain building
D volcanic eruption​

Answers

B: chemical weathering

In an experiment, there are two groups. Which group is not changed in any way?

Answers

Answer:

the control

Explanation:

THe video uses an example of cheerleaders at a sporting event,
building a pyramid as a definition of isostatic adjustment
A: True
B: False

Answers

I would agree with False because you can’t define adjustment like that

I NEED HELP ITS DUE RIGHT NOW PLEASE ( biology question !!! )

Answers

Answer:

A is the correct answer.

Scientists are studying the bacteria living in termites because they want to
genetically engineer......

Bacteria that can resist pests on crops.

Bacteria that can create ethanol from left over plant material.

Bacteria that create a vaccine.

Bacteria that create antibiotics.

Answers

Answer:

B. this is why Those bacteria may contain genes that will help convert plant material to ethanol. so B. and if it's wrong then sorry but if it's right u welcome ;)

Bacteria that can resist pests on crops.

The following information should be considered:

In the case when the scientist should studying the bacteria that lived the termites so it should resisted the pest on the crops. These kind of bacterias should comprise of genes that would helps transform plant material to ethanol.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

What causes the "plastic" nature of
the asthenosphere?
A. it is mostly water
B. it only found under the ocean
C. constant earthquake activity
D. heat from below

Answers

The heat from below causes the "plastic" nature of the asthenosphere. The correct option is D.

What is asthenosphere?

The asthenosphere is the upper mantle's mechanically sluggish and ductile region.

It is located beneath the lithosphere, somewhere around 80 and 200 kilometers underneath the surface, and can extend up to 700 kilometers. However, the asthenosphere's lower boundary is not well defined.

Semi-plastic rock makes up the Asthenosphere. Because of Lithosphere has a lower density, it resides on top of the Asthenosphere, much like an iceberg or a block of wood does on water.

The lower mantle beneath the Asthenosphere is stiffer and less plastic. The outer core is located beneath the Mantle.

The "plastic" essence of the asthenosphere is caused by heat from below.

Thus, the correct option is D.

For more details regarding asthenosphere, visit:

https://brainly.com/question/7152935

#SPJ2

A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet

Answers

Answer:

The answer is D, patient's diet.

Explanation:

As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.

Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.

How is gigantism diagnosed?

If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.

Thus it is clear that medical books will have a medical history of patetint wityh gigantism.

To learn more about gigantism refer to the link :

https://brainly.com/question/7035609

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

What is the relationship between a protein, the cell, and DNA?
A. DNA is produced by a protein which is produced in the cell
B. Protein is composed of DNA which is produced in the cell
C. A cell is composed of DNA and protein
D. DNA controls the production of protein in the cell

Answers

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

The option (B) is the relationship between a protein, the cell, and DNA.

In humans, Brown eyes (B) is dominant to blue eyes (b). A hom ozygous brown-eyed man marries a blue-eyed woman. What are the genotypic and phenotypic ratios of their children’s eye color?

Genotype: __________________________________
Phenotype: __________________________________

Answers

Answer:

The ratio is 50%

Explanation:

Genotype:

Bb

Phenotype: Brown eyes

Please correct me if I am wrong :)

Answer:

3 of the boxes have Capital b and only 1 box have lower case b

Explanation:

Which sediment would have the slowest rate of deposition?
a round sediment
O a very large sediment
an irregularly shaped sediment
O a high-density sediment

Answers

Answer:

C. An irregularly shaped sediment

Explanation:

Deposition is the settling of sediments within respective basins of deposition.

Irregularly shaped sediments are the slowest to settle within a basin this is due to the frictional resistance of their surface.

As these particles hits the water, the liquid drag on their edges is very great and prevents swift settling.

A. A high density sediment and a large sediment will have a fast settling time.

B. Rounded sediments will impose no friction on the water and they fall through the liquid very fast.

Answer:

the answer is C. an irregulary shaped sediment

Explanation:

hope this helps!

what are cork tissues? how are they formed?

Answers

Answer:

Cork is a protective tissue that separates the living cells of the plant from the outside environment. The formation of cork in the periderm is the result of the activity of a secondary meristem, the cork cambium, or phellogen.

Explanation:

Will give brainliest

Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B.

After asking her mother, she finds out that her mother's blood type is A. However, her father cannot remember his blood type.

Which of the following blood types could her father have?

I. A
II. B
III. AB
IV. O
A.
I or III only
B.
I, II, or IV only
C.
I, II, III, or IV
D.
II or III only

Answers

Answer:

C. I, II, III, or IV

Explanation:

I got it right on study island

Jennifer is trying to determine the blood type of her parents for biology class. She knows that her blood type is B. In such case her father may have blood type A,B, AB, and O. Thus, option C is correct.

What is blood group?

The three alleles that are A, B, and O are mainly responsible for controlling the major blood groups such as A, B, and AB, respectively. Due to this fact that humans are considered as diploid, each genotype could only include the maximum of two of them. Just to put it another way, just only two of these alleles could coexist in the single cell of the human at  given time.

IA, IB, and I are considered as the three distinct alleles that could determine the person's blood type. I has been considered as the most common. These three alleles could be referred to as the A (for IA), B (for IB), and O for the sake of simplicity (for i). Because we receive one blood type allele from our biological mother and one from our biological father, each of us has two ABO blood type alleles.

Therefore, option C is correct.

Learn more about blood on:

https://brainly.com/question/14781793

#SPJ3

Which of the following is true of ecological succession? A-pioneer organisms move into new communities first. B-primary productivity decreases as succession proceeds. C-secondary succession takes place within new communities with no previous soil. D-all of the above.

Answers

Answer:  Pioneer organisms move into new communities first.

Explanation:

Which of the following is an example of a negative tropism?

A. stems and leaves growing upward
B. leaves curling when touched
C. roots growing downward
D. leaves turning toward the light

Please help ASAP

Answers

Answer: B because leaves curling when touched is a negative tropism

Explanation:

present and debate current social and ethical implications of biotechnology and genetic engineering

Answers

Answer:

These concerns range from ethical issues to lack of knowledge on the effects genetic engineering may have. One major concern is that once an altered gene is placed in an organism, the process cannot be reversed. Public reaction to the use of rDNA in genetic engineering has been mixed.

I don't know if that's right

What makes each of the mechanical layers different?

A. Whether the layer is rock or metal

B. Whether the layer is solid, liquid, or in between

C. Whether the layer is dense or thick

Answers

.......The answer is B

Which trait is controlled by three or more genes?

A:seed color in pea plants
B:feather color in roosters
C:fur color in palomino horses
D:hair color in humans

Answers

Answer: D:Hair color in humans

Explanation:

I think D but I could be wrong

Generation Number of purple flowers Number of white flowers 1 705 224 2 792 189 3 834 102 4 889 84 5 938 21 6 952 0 Ralph wanted to breed a pea plant that produced only purple flowers. He continued to breed purple-flower producing pea plants together over six generations. The results of Ralph's artificial selection are shown above. What did artificial selection do to the population of pea plants? A. caused a new species of pea plant to form B. increased its genetic diversity C. decreased its genetic diversity D. caused a pea plant to exhibit a new characteristic

Answers

Answer:

C

Explanation:

The correct answer would be that artificial selection decreased the genetic diversity of the pea plant.

Genetic diversity is a measure of the number of traits or characters.

Initially, the breeding produced a considerable population of both white and purple flower offspring. But as time goes on, the population of purple flower offspring increased while that of the white flower decreased till it eventually reached zero.

Thus, artificial breeding reduced the number of traits in the population of the offspring from two to one - a case of reduction in genetic diversity.

The correct option is C.

Answer:

c

Explanation:

Which of the following statements best describes the state of DNA inside of a prokaryotic cell?

a
46 X-shaped chromosomes inside the cytoplasm
b
46 X-shaped chromosomes inside the nucleus
c
a single circular chromosome in the cytoplasm
d
a single circular chromosome in the nucleus

Answers

Answer:

C.

Explanation:

It's a single strand of circular DNA found in the central area of the cell, which is not surrounded by a nuclear membrane.

what is alleles and how are they related to genes ?​

Answers

Answer:

An allele is a variant form of a gene . Some genes have a variety of different forms , which are located at the same position , or genetic locus , on a chromosome . Humans are called diploid organisms because they have two alleles at each genetic locus , with one allele inherited from each parent.

Explanation:

Believe it

Which statement describes an interaction between the biosphere and the atmosphere that is related to
photosynthesis?
O During photosynthesis, plant roots take in water from soil.
O During photosynthesis, plants take in carbon dioxide from the air.
O Through photosynthesis, energy stored in plants is released into the air.
O Through photosynthesis, energy stored in plants is transferred to humans who eat them.

Answers

Answer:During photosynthesis, plant roots take in water from soil.

Explanation:

Answer:

During photosynthesis, plants take in carbon dioxide from the air.

Explanation:

The second answer is correct because it includes an interaction between the atmosphere and the biosphere.

Can anyone give me two mineral feed ingredients for poultry birds ?! 20 points for it

Answers

Answer: aragonite oyster shell crab meal

Explanation: aragonite is for calcium and oyster shell also has calcium. Crab meal provides small amounts of protein and minerals

1. When a consumer eats a producer, 10 percent of the producer's energy is passed on to the consumer trophic level. What happens to the other 90 percent?

A. It is added back to the soil by decomposers.


B. It is used by the producer to pass on to the next trophic level.

C. It is used for cell processes or released as heat.

D. It is consumed and used by the consumer.

2. Why is there less biomass at the top of the energy pyramid?
A. Secondary and tertiary consumers have to consume a lot more food to support themselves, so there are fewer of them.

B. Secondary and tertiary consumers live longer, so there are fewer of them because they reproduce more slowly.

C. Secondary and tertiary consumers are larger, so there are fewer of them.

D. Secondary and tertiary consumers have bigger ranges, so there are fewer of them because they each need a lot of space.

3. Using the ten percent rule, determine how many kilocalories of energy the tertiary consumer tuna will receive.

Algae: 135,000 Kcal
Shrimp: _
Lantern Fish: _
Tuna: _

A. 135 Kcal

B. 1,350 Kcal

C. 135,000 Kcal

D. 13,500 Kcal

4. Read the following statements about various species of plants and animals. Which one would be classified as an invasive species?

A. Kudzu, a plant from Japan, was introduced as a foliage crop and to reduce soil erosion. It grows up to a foot per day, smothering low-growing plants and killing trees.

B. Dandelions are plants from Eurasia. They are often considered weeds by homeowners and killed off by using herbicide. They can be consumed in salads or as tea and are the first food resource for bees in the spring.

C. Honey bees are from Europe and can sting people. They are often farmed in America for their ability to pollinate and provide honey.

D. Loosestrife beetles, native to Eurasia, have been released in various American states to combat the invasive plant, purple loosestrife.

5. Using the following formula to find the efficiency of energy transfer between the harbor seal (2,500 Kcal) and a polar bear (375 Kcal)
(Energy level transferred to next level) / (Total energy input) × 100

A. 15%

B. 20%

C. 10%

D. 12%

Thank you so much if you answer this:) I'm working on it and will probably figure them out but a little help would be appreciated. <3​

Answers

Answer: I just to happen to be working on this quiz right now. I got 5/5 on it, so I hope this helps :D

~Ten Percent Rule Quick Check~

1. B) It is used for cell processes...

2. D) Secondary and tertiary consumers have to consume a lot more..

3. D) 135 Kcal

4. C) Kudzu, a plant from Japan...

5. A) 15%

^This is confirmed valid as of January 17th, 2022^

Consumers are the organisms that depend on others for food and energy for the metabolic process while the producers produce their food at the trophic levels.

The correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

The trophic levels can be explained as:

1. In the trophic levels the energy gets decreased as it passes from one level to another because it is used in the cellular process it is released in the form of heat.

2. Secondary and tertiary consumers have to feed a lot and hence, they are fewer in number compared to the producers. They maintain the population and balance out the producer and consumer ratio.

3. According to the 10 % rule of energy transfer, the Tuna will receive 135 Kcal of energy because the energy decrease by 10% as one moves from the lower trophic to the upper levels.

4. The species that are non-native to a place or region are called invasive species hence, the Kudzu plant is the invasive species as it is introduced from Japan.

5. Given,

Energy of Seal = 2,500 Kcal

The energy of polar bear = 375 Kcal

The 10% of 2500 will be 250 and the 5 % 125 thus, 15% is the efficiency.

Therefore, the correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

Learn more about energy transfer and trophic level here:

https://brainly.com/question/20586850

can someone pleasee answer thiiisss pleasee

Answers

Answer:

Hi how are you doing today Jasmine

Adaptation is a change in a species over many generations. What is the cause of this change?

A.
The environment changes over time.

B.
Species pick traits they like.

C.
Over time, species become more like their ancestors.

Answers

Answer: is C

Explanation:

Answer:  The correct answer is A. The environment changes over time.

Explanation:  Adaptations allow species to be able to survive in changing locations, like Darwin observing changes in bird beaks based on their available food sources.

I was wondering if my answer was right ?

Answers

Explanation:

yes the 4th one is right so yes the one you have is right

Secondary consumers are organisms that eat primary consumers for energy. Primary consumers are always herbivores, or organisms that only eat autotrophic plants. However, secondary consumers can either be carnivores or omnivores.

with that said, yes! your answer is correct. there are other secondary consumers in the other options, but the answer you selected it the only one with everything species listed is a secondary consumer
Other Questions
Which fraction and decimal forms math the long division problem Please help asap The sales tax rate is 10%. If Carla buys a handbag priced at $90, how much tax will shepay? Can someone help me out Positive feedback caused his pancreas to stop secreting insulin. Negative feedback caused his pancreas to stop secreting insulin. Negative feedback caused his pancreas to produce more insulin. Positive feedback caused his pancreas to produce more insulin. Based on the Resource Use and Conservation Virtual Lab, Which tactic can do the most to keep the water debt less than the water supply?A. Outlawing water features in gardens B. Replacing drip irrigation systems C. Outlawing drip irrigation systems D. Replacing thermal power plants. What is one difference between natural selection and artificial selection? a)Natural selection involves humans; artificial selection does not involve humans b)Natural selection does not involve humans; artificial selection involves humans c)Natural selection takes longer than artificial selection d (Artificial selection only involves plants; Natural selection only involves animals What is the mollusk tongue called? B Insect 1 : Vespula flavopilosaInsect 2: Vespula rufaInsect 3: Callicera rufa(a) Insects 1 and 2 are more closely related to each other than to insect 3. (i)Explain how the binomial names indicate that insects 1 and 2 are more closely related. (i)Explain how the appearance of the three inswcts suggest that insects 1 and 2 are more closely related.HELPPP I NEED TO KNOW NOWWWW!! Find the coordinates of the orthocenter of a triangle with the vertices (5,3), (8,6), (0,14) at each set of points on a coordinate plane? Which of the following contributed to the failure of Prohibition?OA. Organized crime controlled illegal alcohol production.O B.Rural America failed to support it.Oc. Many Americans didn't consider drinking to be a crime.OD.It adversely affected American productivity. .It was not imposed strictly on immigrants. 10+x=21 ?Whats the answer The brain is most active during which portion of each sleep cycle?A. the beginning of each sleep cycleB. the middle of each sleep cycleC. the end of each sleep cycleD. The brain is not active during the sleep cycle.Please select the best answer from the choices provided write about a dinning place that you have visited in your hometown use some of the vocabulary that you have learned: me gusta, no me gusta, auto servicio, propina, reserva,camarero Many members of Congress will leave politics and become a ________ as a profession? I remember well the remark made to me once by one of my teachersand a very good teacher, too, who nevertheless did not see what her own observation ought to have suggested. School-children, she said, regard teachers as their natural enemies. The thought which it would have been logical to suppose would have followed this observation is, that if children in general are possessed of that notion, it is because there is a great deal in the teachers treatment of them which runs counter to the childs nature: that possibly this is so, not because of natural cussedness on the part of the child, but because of inapplicability of the knowledge taught, or the manner of teaching it, or both, to the mental and physical needs of the child. I am quite sure no such thought entered my teachers mind,at least regarding the system of knowledge to be imposed; being a sensible woman, she perhaps occasionally admitted to herself that she might make mistakes in applying the rules, but that the body of knowledge to be taught was indispensable, and must somehow be injected into childrens heads, under threat of punishment, if necessary, I am sure she never questioned. It did not occur to her any more than to most teachers, that the first business of an educator should be to find out what are the needs, aptitudes, and tendencies of children, before he or she attempts to outline a body of knowledge to be taught, or rules for teaching it. It does not occur to them that the childs question, What do I have to learn that for? is a perfectly legitimate question; and if the teacher cannot answer it to the childs satisfaction, something is wrong either with the thing taught, or with the teaching; either the thing taught is out of rapport with the childs age, or his natural tendencies, or his condition of development; or the method by which it is taught repels him, disgusts him, or at best fails to interest him.When a child says, I dont see why I have to know that; I cant remember it anyway, he is voicing a very reasonable protest. Of course, there are plenty of instances of wilful shirking, where a little effort can overcome the slackness of memory; but every teacher who is honest enough to reckon with himself knows he cannot give a sensible reason why things are to be taught which have so little to do with the childs life that to-morrow, or the day after examination, they will be forgotten; things which he himself could not remember were he not repeating them year in and year out, as a matter of his trade. And every teacher who has thought at all for himself about the essential nature of the young humanity he is dealing with, knows that six hours of daily herding and in-penning of young, active bodies and limbs, accompanied by the additional injunction that no feet are to be shuffled, no whispers exchanged, and no paper wads thrown, is a frightful violation of all the laws of young life. Any gardener who should attempt to raise healthy, beautiful, and fruitful plants by outraging all those plants instinctive wants and searchings, would meet as his rewardsickly plants, ugly plants, sterile plants, dead plants. He will not do it; he will watch very carefully to see whether they like much sunlight, or considerable shade, whether they thrive on much water or get drowned in it, whether they like sandy soil, or fat mucky soil; the plant itself will indicate to him when he is doing the right thing. And every gardener will watch for indications with great anxiety. If he finds the plant revolts against his experiments, he will desist at once, and try something else; if he finds it thrives, he will emphasize the particular treatment so long as it seems beneficial. But what he will surely not do, will be to prepare a certain area of ground all just alike, with equal chances of sun and amount of moisture in every part, and then plant everything together without discrimination,mighty close together!saying beforehand, If plants dont want to thrive on this, they ought to want to; and if they are stubborn about it, they must be made to.In the second sentence of the second paragraph, the repetition of the word things primarily serves toqualify a claim by acknowledging an exception to itAportray contrasting viewpoints as equally legitimateBclarify an argument by restating it in simpler termsCillustrate a generalization with a particular caseDstrengthen an assertion by broadening its implicationsE xxsaaaaaaaaaaaaaaaaaaaaaaa How can polynomial functions be written when given the zeros? Why were upper class members of newly conquered lands given Roman citizenship?Group of answer choicesto make them loyal to the empireto help recruit solders into the armyto allow them to vote for the emperorto increase the population of the empire What does RNA Mean? Alexa remind me to use 3 as my use button and bind f to my ar on PC whats does concept of mole chemistry question