Answer:
stem cells
Explanation:
Under certain external conditions, a person will perspire a great deal. For which internal condition does this response primarily provide homeostasis?
Answer:
Abnormally high temperature
Explanation:
Sweating or perspiration is a homeostatic response to abnormally high body temperature. Evaporation of the sweat causes cooling of the body and this causes the temperature of the body to return back to normal.
When the setpoint temperature of the body is breached by being too high, the negative feedback mechanism kicks-in, and the sweat glands of the skin becomes activated. The body sweats, and the evaporation of the sweat from the surface of the skin causes cooling and a return back to the setpoint.
Calculate the mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2
Answer:
40kg
Explanation:
F=M*A
M=F\A
M=400\10
M=40kg
The mass of an object whose weight is 400 N and acceleration due to gravity is 10 m/s2 is 40 kg.
What is acceleration due to gravity?The net acceleration that objects get as a result of the combined action of gravity and centrifugal force is known as the Earth's gravity, or g.
It is a vector quantity whose direction, strength, or magnitude match a plumb bob.
According to Newton's second law, an object's acceleration is inversely proportional to its mass and directly connected to the net force. An object's acceleration is determined by two factors: force and mass.
We know that,
F = m x g
m = f/g
Where,
F = force
m = mass
g = acceleration due to gravity
Given that,
F = 400N.
g = [tex]10m/s^2[/tex]
So,
m = 400/10
m = 40 kg.
Thus, the mass is 40 kg.
For more details regarding acceleration due to gravity, visit:
https://brainly.com/question/13860566
#SPJ6
Write any three differences between mass and weight
please its aurgent fast
Answer:
See explanation
Explanation:
There are a number of differences between mass and weight, they include;
Mass is a scalar quantity whereas weight is a vector quantity.
Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.
The SI unit of mass is kilogram whereas the SI unit of weight is Newton.
16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits
Answer:
C
Explanation:
The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.
There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.
A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.
Hence, the correct option is C.
The recessive gene for blood typing s...
Type O
Type A
Type B
Type AB
Answer:
Image result for what is The recessive gene for blood typing
Because A is dominant, that means your mother could carry a hidden O. If she does then when she gets pregnant, each child has a 50% chance of getting her dominant A and a 50% chance of getting her hidden, recessive O. If the child gets the O from mom and an O from dad, he or she will have an O blood type.
Explanation:
Brainliest if right?
I WILL GIVE BRAINLIEST
Use the image to answer the question.
The image shows a food chain. An arrow points from grass to a grasshopper. An arrow points from the grasshopper to a lizard. An arrow points from the lizard to a hawk. An arrow points from the hawk to a fox.
What would happen if the number of grasshoppers in this food chain decreased?
A.
The amount of grass would increase.
B.
The number of lizards would increase.
C.
The amount of grass would decrease.
D.
The number of hawks would increase.
Answer:
a, the amount of grass would increase
Explanation:
if the grasshopper is the one in this diagram eating the grass, and suddenly there were fewer grasshoppers to do that, the grass would increase because more of it can grow without being eaten
Jimmy and Marquis are conducting an experiment in class. They have
planted four seeds in four different pots. They placed the pots in different
places around the classroom: in a sunny window, on the work table, on the
floor near the window, and under the boys' desk. The boys watered the
pots every morning when they arrived at school. Once the seeds sprouted
the boys measured how much each seed grew. "Wowl" said Marquis, after
3 weeks of observing and measuring, "I can tell which seed was under our
desk!" Can you? Which seed was placed under the boys desk?
Measuring Plant Height
10
Plant Height (Inches)
Seed 1 Seed 2 Seed 3 Seed 4
The diagram shows four pairs of chromosomes from the karyotype of a normal human male.
Select the pair of sex chromosomes.
Answer:
According to the karyotype image, the sex chromosomes of a normal human male are those of the last picture, where both are different.
Explanation:
The sex chromosomes are those that determine the sex in a species, as in the human being and other species X and Y. XY chromosomes determine the male sex while the XX sex pair corresponds to the female sex.
In humans, the chromosomes are grouped by pairs with the same characteristics, that is, most pairs of chromosomes are identical. The only exception is represented by the male human sex chromosomes X and Y. This difference in the sex chromosomes causes the different sex chromosomes (picture) to be called heterogametic.
4. Compare and Contrast Which kind of plant–a sun plant or a shade plant-has a
higher rate of photosynthesis when light intensity is below 200 umol photons/mº/s?
When light intensity is above 400 umol photons/mº/s?
Answer:
Below 200 umol photons/mº/s, shade plant grow best.
Above 400 umol photons/mº/s, sun plant grow best.
Explanation:
A shade plant has a higher rate of photosynthesis when light intensity is present below 200 umol photons/mº/s because shade plants needs low light intensity for higher photosynthesis while on the other hand, a sun plant has a higher rate of photosynthesis when light intensity is above 400 umol photons/mº/s because it requires high intensity of light for photosynthesis if other factors are also present in large amount such as water and nutrients in the soil.
structures in the cell
A cell consists of three parts: the cell membrane, the nucleus, and, between the two, the cytoplasm. Within the cytoplasm lie intricate arrangements of fine fibers and hundreds or even thousands of miniscule but distinct structures called organelles.
People in the Middle Ages were beginning to question:
Drama
Authority
Scientists
Wyatt has heart problems
Answer:
If Wyatt has heart problems, Wyatt can eat healthy foods to try and decrease the problems, Wyatt can also make sure that his weight and blood pressure isn't to high. Wyatt can try to get seen at the hospital to make sure everything is fine.
give two examples of asexual Productions
Answer:
Asexual Reproduction Examples
Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v
How does biology affect behavior?
Answer:
some behaviors may have a genetic basis, but genes do not actually control behavior. Rather, our genetic makeup influences how we interact with and respond to our surroundings.
Explanation:
There you go
when an experiment shows that two variable are closely related the experiment shows what
Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.
Explanation:
Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem
Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal
Answer:
dragon warrior or whatever it is called I don't maybe I am right
tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed
Answer:
Naruto usamaki is the greatest hokagey in the leaf village
To sciences do not agree on which type of grocery bag is better for the environment what is the most likely outcome of this disagreement
Answer:
paper bags jute bags , cotton bags might be used for the environment
1) BB x bb (B=Brown, b=blue) 2) Aa x Aa (A=Tall, a=short) 3) DD x Dd (D=Rough,d=smooth) 4) Ee x ee (E=Stripes, e-soild). ? help someone
Answer:
1) Brown, 2)Tall with a 25% chance of short 3) Rough 4) 50% chance of solid 50% chance of stripes
Explanation:
The big letters are the dominant. Dominant always shows up if its part of it. The genetic squares show that any square with a Big letter will present the big letters trait. i didnt really understand so i hope this is what you're looking for
The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.
Answer:
The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.Explanation:
PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS
Answer:The answer is the person and the tennis ball :)
Explanation:
explain in details the mechanism of transportation in plants
Answer:
Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.
Explanation:
I hope I helped:)
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
please help
Explain how an organ and organelles are related
Answer:
Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.
Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.
What is the relation between organ and organelles?Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.
Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.
Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.
Therefore, organ and organelles differ in their functioning.
Learn more about organ and organelles here:
https://brainly.com/question/22911736
#SPJ2
What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT
Answer: A U G U G G A A C C G C U G C U G A
Explanation:
Answer:
AUGUGGAACCGCUGCUGA
Explanation:
What determines which bases will be brought to the DNA strand during DNA replication?
if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died
Answer:
There are 1600 atoms when organism just died.
Explanation:
The statement is incorrect. The correct statement is:
If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?
The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:
[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)
Where:
[tex]n_{o}[/tex] - Initial amount of atoms.
[tex]n(t)[/tex] - Current amount of atoms.
[tex]t[/tex] - Time, measured in years.
[tex]\tau[/tex] - Time constant, measured in years.
In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:
[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)
If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:
[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]
[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]
[tex]\tau \approx 8,266.643\,yr[/tex]
[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]
[tex]n_{o} \approx 1600[/tex]
There are 1600 atoms when organism just died.
Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass
Answer:
D. The glass.
Explanation:
Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.
Hope this helps :D