Answer: C. Inequalities in health care
Explanation: (A P E X)
Answer:
C. Inequalities in health care
Explanation:
If two different species belong to the same family, then they also belong to the same _______. *
Kingdom
Class
Order
All of the above are correct
Answer:
All of the above
Explanation:
The order is Domain, Kingdom, Phylum, Class, Order, Family, Genus, Species.
If it is a smaller one it is always in the ones above it.
Summarize the possible applications of gene knockout GMOs.
Answer:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
Explanation:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC
17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)
the other liquid waste product in cellular respiration is
Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.
Explanation: Hope dis helps :)))))
Answer:
the waste products are carbon dioxide and water
Which of the following solutions would have solute concentration that is lower than the concentration found inside the cell
Answer:
hypotonic solution
A hypotonic solution has a lower solute concentration than inside the cell (the prefix hypo is Latin for under or below). The difference in concentration between the compartments causes water to enter the cell.
Thank you and please rate me as brainliest as it will help me to level up
Answer:
A. Hypotonic Solution
The process of photosynthesis converts carbon atoms from carbon dioxide into
Its easy! If right will give brainlist! Don't overthink..:) Just answer
The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks
Answer:
When the mirror is inside the focal point..?
PLEASE HELP
the question is in the pic
Hemoglobin is:
1) hormone;
2) Enzyme
3) protein;
4) Amino acid
HELPPP PLEASE!!!!
Answer:
The oxygen- carrying pigment and predominant protein in the RBC.
Which of the following statements regarding prokaryotic and eukaryotic cells is true
Answer:
I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells
Answer:
They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.
Hope this helps, have a great day/night, and stay safe!
Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual
Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.
What are genes?
Genes are composed of DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.
The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.
Genes code for the traits such as the color of eyes, height quality of hair, and more.
Learn more about genes, here:
https://brainly.com/question/31121266
#SPJ2
explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.
Explanation:
During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.
Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.
HELP!!!!15 POINTS!!!!!!
i think it's f but idk..
Answer:
F is good
Explanation:
Which is an example of active transport?
a
Cells move sugar into their cells with energy
Water moves from where there is more water to where there is less
b
с
Salt moves from a 15% solution to a 2% solution
d
Dye moves from where it is dropped throughout an entire glass of water
Answer:
с ) Salt moves from a 15% solution to a 2% solution
Explanation:
In active transport, the particles move across a cell membrane from a lower concentration to a higher concentration. Active transport is the energy-requiring process of pumping molecules and ions across membranes "uphill" - against a concentration gradient.Aug 14, 2020
To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden
Answer:
To preserve vegetation and soil fertility of land
Explanation:
.
A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.
What is nucleotide?It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.
These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder. The type of sugar that is used in a DNA helix is called deoxyribose.
Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.
Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.
Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.
Learn more about white blood cells on:
https://brainly.com/question/19202269
#SPJ5
to which class of macromelules do anitbodies belong to
Pls answer now I am giving 40 points
Answer
:proteins
The four classes of macromolecules are carbohydrates, proteins, nucleic acids, and lipids. These biomolecules can also be referred to as polymers. In turn, we will discuss how these four classes of macromolecules are synthesized in the cell from their constituent building blocks or monomers.
Explanation:
Antibody Classes. Antibodies can be divided into five classes—IgM, IgG, IgA, IgD, IgE—based on their physiochemical, structural, and immunological properties. IgGs, which make up about 80 percent of all antibodies, have heavy chains that consist of one variable domain and three identical constant domains.
Answer:
Antibodies are proteins. An antibody (Ab), also known as an immunoglobulin (Ig), is a large Y-shape protein produced by plasma cells that is used by the immune system to identify and neutralize foreign objects such as bacteria and viruses
Explanation:
Which refers to the sum of all the forces that act upon an object?
A. net force
B. absolute force
C. balanced force
D. positive force
Answer:
Net force
Explanation:
Net force is the vector sum of forces acting on a particle or body. The net force is a single force that replaces the effect of the original forces on the particle's motion. It gives the particle the same acceleration as all those actual forces together as described by the Newton's second law of motion.
Answer:
net force
Explanation:
Someone please help!!! Anyone!?!? I'll give A Brainliest
Answer:
These are Punnet squares. The answer for 1 is 50% The answer for 2 is 100%
The answer for 3 is 100%
Explanation:
I hope this helps!! Have a great day!!!
What is the definition of cell
Answer:
Small and sparsely furnished room, especially in a prison or convent.
"the detainees are together in cells with capacity for four or five people"
Cell of a honeycomb.
Explanation:
I hope to help you
In the United States, most racial discrimination comes in the form of ________ discrimination.
A. Direct
B. overt
C. indirect
D. extra
Answer:
C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.
Explanation:
In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.
What is indirect discrimination?Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.
Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.
Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.
Therefore, indirect discrimination is the most common form of discrimination observed in the United States.
Learn more about indirect discrimination here:
https://brainly.com/question/14710203
#SPJ7
A _____
wave can travel in the absence of matter.
a. light
b.sound
c.seismic
d.water
Helppp please
Which federal agency, formed in 1977, now combines regulation and other aspects of the energy industry that were
previously scattered under several other agencies?
O Occupational Safety and Health Administration
O Mine Safety and Health Administration
OU.S. Energy Information Office
o Department of Energy
D. Department of Energy (DOE)
Explanation: The DOE has been officially in charge of all aspects of energy since 1977; their activities prior to this were assigned to various different government agencies.
Answer: The correct answer is Department of Energy (DOE)
Explanation: This answer has been confirmed correct.
BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain
Answer:
October
Explanation:
October is one of the hurricane season months
Cellular respiration is a process in which animal cells use ____ taken in from the atmosphere.
1) carbon dioxide
2) hydrogen
3) oxygen
Answer:
How does cellular respiration work in animals?
When an animal breathes, it takes in oxygen gas and releases carbon dioxide gas into the atmosphere. This carbon dioxide is a waste product produced by the animal's cells during cellular respiration. Cellular respiration occurs in the individual cells. Digested foods have chemical energy stored in them.
Explanation:
A human liver cell has a different size and shape from a human muscle cell. What is the best explanation for these differences?
A. The cells perform different functions.
OB. One of the cells is used to reproduce more cells while the other is not.
OC. One type of cell develops into the other type of cell.
OD. One of the cells must have come from another species.
Answer:
A
Explanation:
A human liver cell would have a different size and shape from a human muscle cell because they perform different functions in the body.
The shape a cell would assume and its size depends on the function the cell performs. The functions of the liver in the body of humans differ greatly from the functions of muscles. While the former helps in detoxification, deamination, digestion, etc., the latter helps in support, movement, etc.
The correct option is A.
A human liver cell has a different size and shape from a human muscle cell because the cells perform different functions.
CELL:
Cell is the basic and fundamental unit of life. It is the simplest level of organization of an organism. Cells contain organelles that help them perform specific functions. Organs are made up of numerous cells. Similar cells perform similar functions while dissimilar cells perform dissimilar functions. Therefore, a human liver cell has a different size and shape from a human muscle cell because the cells perform different functions.Learn more at: https://brainly.com/question/22663686?referrer=searchResults
It is not the number of different nucleotides, but the ________________ that is important in the ability of DNA to code for all the variability of organisms.
I'll mark brainlest
Answer:
discupa eu não sei
uma bela noite abençoe
Multiple Choice Question:
Metabolizing proteins refers to breaking them down and changing them so that your body can use them. if you eat an egg, the proteins in the egg must be ______________ for use
A. metabolized
B. plagerized
C. synthesized
Answer:
A, metabolized
Explanation:
^^ Hopefully this helps!
what is the complementary dna strand of C-C-T-A-G-C-T
Answer:
G-G-A-T-C-G-A
Explanation:
The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.
1.
2.
3.
4.
What is the Answer?
Answer:
the answer is 3
Explanation: