What are the types of seeds and classes of seeds?

Answers

Answer 1

Answer:

Nucleus, Breeder, Foundation, and Certified.

What is a seed?

One of the ways in which a plant produces another plant of its own kind is the seed. Just as birds lay eggs to reproduce their kind, the plant grows a seed that makes another plant.

The flower or blossom of a plant must be fertilized or the seed it produces will not grow. After the seed is fully grown, or mature, it must rest. The rest period varies among different kinds of seeds. Many of them will not grow until they have rested thru the winter.

Seed growth requires moisture, oxygen, and warmth. Light helps some plants start seed growth. If seed growth doesn't start within a certain time, the seed will die. When seeds are stored by man for future use, they must be kept dry and within a certain temperature range.

Seeds vary greatly in size, shape, pattern, and color. The seeds of different plants are made in different ways. There is one kind of seed, for example, that has the tiny new plant in the center. Around this is stored food which will tide the young plant over until it has developed roots and leaves and can make its own food.

If a seed is fertile, has rested, and has received the moisture, oxygen, and warmth, it begins to grow. This is called “sprouting” or “germination.” Growth often starts when moisture reaches the seed. As the seed absorbs water, it swells. As chemical changes take place, the cells of the seeds begin to show life again and the tiny young plant within the seed begins to grow. Most parts of the seed go into the growing plant. The seed cover drops off and the new plant grows larger until it matures and makes seeds of its own.

Seeds may be small or large. Begonia seeds are so small they look like dust. Coconuts are seeds which may weigh as much as 40 pounds! Some plants have only a few dozen seeds, while others, such as the maple, have thousands. There are special ways seeds are made so that they will be spread. Burr-type seeds hitch a ride on the fur of animals. Seeds that stick in mud cling to animals feet. Seeds contained in fruit are carried by man and animals. Some seeds have "wings" and are blown by the wind, other seeds float on water, and some are even "exploded" away from the parent plant!


Related Questions

can someone please help me, i dont know how to answer this. please give me pointers

Answers

Because, the passage itself describes about the nature of greenhouse effects. The greenhouse gases are absorbed by the soil. In order to protect the sensitive plants, we are going now for the modern greenhouse method i.e. artificial method. Transparent material which is nothing but like a sheet which covers the house is contructed to oppose the greenhouse gases to protect the plants. As the heat passes, some amount of heat won't escapes to atmosphere. This results in excess heat inside and leads the plants to die. Scientists say it's better to be the natural method of greenhouse effects.

ACADEMIC STUDY ON NATURAL SELECTION, THIS IS NOT A TEST!!!

Answers

Answer is A. Wild population

A plane is traveling 800 kph west. If the forces of lift, weight, thrust, and drag upon are in equilibrium for the whole time of the flight, what will the velocity of that plane be after three hours?

Answers

Answer is : 266.67

Explanation:
800kn=v • 3
V= 800km / 3
V= 266.67

The stamen, pistil and petals are a part of which living thing?

Answers

Answer:

A flower

Explanation:

All of the following are examples of environmental mutagens except

x-rays.

viruses. (Correct)

pesticides.

sunlight.

Answers

All of the following are examples of environmental mutagens except : sunlight as it does not pollute the environment.

What is meant by environmental mutagens?

Agents that can cause mutations in DNA and increase the frequency of mutations in a population is known as environmental mutagens. Examples of environmental mutagens are : x-rays, UV radiation, certain chemicals such as pesticides, and some naturally occurring substances like aflatoxins produced by fungi.

Mutagens are the substances that have the ability to change the genetic composition of a person / animal and these changes caused by mutagens are referred to as genetic mutations. Major target of mutagens is DNA.

To know more about environmental mutagens, refer

https://brainly.com/question/9628269

#SPJ1

Dr Lee has asked you to describe the diagnosis and risk factors of the disease to the patient. What would you tell Shino about her diagnosis

Answers

High 24-hour urine calcium levels and low vitamin D levels suggest that Shino's body is not absorbing the calcium needed to maintain bone mass. She also has a bone density scan score of -3 which is indicative of an osteoporosis diagnosis.

List 5 establishments or firms related in hospitality business that uses the green supply management to cater to their costumer yet to achieve costumer satisfaction and name the items or supplies

Answers

Answer:

Explanation:

dxesrtgbm xzetfg

Answer:

Here are 5 establishments/firms related to the hospitality business that use green supply management:

1. Marriott International - This hotel chain has committed to sustainable sourcing for a variety of items, including seafood, coffee, and cotton.

2. Hilton Worldwide - Hilton is committed to sustainable sourcing of seafood, palm oil, and paper products, among others.

3. InterContinental Hotels Group - This hotel chain is committed to sustainable sourcing of seafood, coffee, and palm oil.

4. Starbucks - While not strictly a hospitality business, Starbucks is a major supplier of coffee to many hotels and restaurants. The company has committed to sustainable sourcing of coffee beans and paper products.

5. Whole Foods Market - This grocery chain supplies many hotels and restaurants with organic and sustainably sourced produce, meat, and other food items.

Question to answer: Do you feel that the Mcdonaldization of society is problematic or not? Explair
What to include:
At least 5-6 sentences
Your opinion
What should I write about

Answers

Answer:

The McDonaldization of society, a term coined by George Ritzer, refers to the homogenization and standardization of society, particularly in the realm of fast food and consumerism. In my opinion, the McDonaldization of society is problematic because it promotes a culture of conformity, where individuality and diversity are devalued. It also prioritizes efficiency and predictability over quality and uniqueness. The emphasis on speed and convenience has led to the proliferation of unhealthy and unsustainable food options, contributing to public health issues and environmental degradation. Moreover, the McDonaldization of society has resulted in the exploitation of low-wage workers and the concentration of wealth and power in the hands of a few large corporations. Overall, I believe that society should strive to promote diversity, creativity, and sustainability, rather than succumbing to the homogenizing forces of McDonaldization.

Explanation:

Anyone know how to solve this? It's biotechnology haha.

Answers

Based on the gel results, patient A has lower levels of the protein corresponding to standard IV in their blood.

The protein that is different in patient B is the one corresponding to the band that did not match with any of the standards. The fact that the band on the gel for patient B was smaller in size compared to the control band suggests that the protein is of smaller molecular weight than the standard.

What is the significance of the results of the protein levels for patients  A and B?

Since these are essential blood proteins, the difference in protein levels for both patients may have implications for their health.

For patient A, lower levels of the protein corresponding to standard IV may indicate a potential health issue related to the function of that protein.

For patient B, the difference in the size of the protein may indicate a mutation or alteration in the gene responsible for encoding that protein, which could lead to a functional difference or potential health issue. Further testing and analysis would be needed to determine the specific implications for each patient.

Learn more about protein levels at: https://brainly.com/question/29520808

#SPJ1

If I push on the ground with my foot with a force of 140 N Backwards, what will the force pushing my skateboard be?

Answers

The force pushing your skateboard will be equal in size and the opposite of the force your foot applies to the ground, assuming there is no friction between the skateboard and the ground.

Skateboard: What is Newton's third law?

Newton's first law states that unless another force acts on an item in motion, it will continue to move in the same direction and at the same pace. As long as no force is applied to a rolling skateboard, it will continue to move in the same direction and at the same pace.

What will happen if you're standing on the floor to the force of your body pressing down on it?

Every action has an opposite and equal response, according to Newton's third law. You may not realize it, but when you stand on the ground, you are exerting force against the ground since gravity is pulling you down due to your weight. The floor is pushing back in response.

to know more about skateboard here:

brainly.com/question/30286828

#SPJ1

Question 16 of 25
What is gene flow?
A. Two populations transferring genes
OB. When a population splits in two
OC. Selection for extreme traits
OD. A mutation becoming more common
SUMIT

Answers

A. Two populations transferring genes is gene flow

What alters two populations due to gene flow?

Gene flow has the effect of reducing genetic diversity among populations, inhibiting or delaying the development of populations in various geographic locations into distinct species of the disease.

The frequencies of alleles will fluctuate as a result of gene flow, the transfer of alleles caused by the movement of people or gametes across populations. Evolutionary change, which is frequent in natural populations, comes from deviation from any of these requirements.

Gene flow increases genetic variation when there is a continuum of alleles in the same way that a source of small-effect mutations would.

learn more about Gene flow

https://brainly.com/question/2698940

#SPJ1

What model of psychology represents a popular attempt at integration

Answers

Answer:

The model of psychology that represents a popular attempt at integration is the biopsychosocial model. This model proposes that psychological and behavioral factors are influenced by biological, psychological, and social factors, and that all of these factors interact with each other to shape human behavior and mental processes. It emphasizes the importance of understanding the interplay between biological, psychological, and social factors in order to develop a comprehensive understanding of mental health and illness. This model has gained popularity in recent years as a more holistic approach to psychology that integrates multiple perspectives and areas of study.

Explanation:

what is the role of a scientist

Answers

To study the different parts of our planet and existence on earth and come up with theories on why its all here. Eg Why were all on earth and whats outside of what we have already found out. They try to come up with explanations on why everything exists. :)

PLS HELP I GIVE BRAINLIEST.

As you have learned in this lesson, arthropods are the largest phylum of animals. In this activity, you will need a notebook and a pencil or pen. You will investigate the natural surroundings of a place of your choice and search for critters in the arthropod phylum. Look under logs, rocks, in gardens, and other moist places. Each time you find one, if you know the name of it, write it down in a list. Otherwise, give it a name based upon its descriptive characteristics.

Place a tally mark next to an arthropod every time you find another of its kind, this way you can record how many of the same species you observe. Look in many different mini-habitats so you can find different types of arthropods.
Make careful observations about their body parts, the way they move, and how they respond when they notice your presence.

Answer the following questions:
Where did you find the most arthropods?
Which arthropod was most common in the areas you looked?
Which creatures did you find least often?

Answers

1. I found the most arthropods in a small forested area near a pond. There were so many different types of creatures to observe, it was incredible.
2. The most common arthropod I found was a type of beetle that had a shiny green carapace.
3. They were crawling all over the place! The creatures I found least often were a type of spider that was very small and hard to see. I only found a couple of them hiding under some leaves.

Jeannie was studying heredity and drew the illustration shown below.

Image

What is Jeannie showing with the dark lines inside each cell?

Answers

Anything that can be seen inside the nucleus of a cell. Proteins and DNA are organised into genes, which form a chromosome.

What are chromosomes and how many are there?

Chromosomes—threadlike structures made up of protein and a single DNA molecule—are used to carry genetic information from cell to cell. Chromosomes are housed in the nucleus of cells in both plants and animals, including humans.

Each cell normally has 23 pairs of chromosomes. Chromosomes, according to Sutton and Boveri's Chromosomal Theory of Inheritance, are the means by which genetic inheritance is conveyed. Rather, chromosomal behaviour includes segregation, independent assortment, and, on rare occasions, linkage; neither Mendelian genetics nor gene linkage are completely true.

To know more about chromosome visit:

brainly.com/question/1596925

#SPJ9

what kind of spider is this, it's on a wild daffodil. I've named it Monica.​

Answers

Answer:

Long leg sac spider

Explanation:

Because it has long legs and the back looks like a sac hope this helps

what happens to the frequency of non beneficial traits in the population over time in simple terms?

Answers

The frequency of non-beneficial traits in a population tends to decrease overtime due to natural selection. These traits do not provide any advantage to an organism in its environment, and may even be detrimental to its survival or reproduction.

Organisms with non-beneficial traits may be less likely to survive and reproduce, so their genes are less likely to be passed on to the next generation.

Which part of the body contains bile an enzyme that helps down lipids

Answers

Answer:

liver

Explanation:

The liver produces bile, a solution that helps you digest fats. The gallbladder stores bile. As fatty food enters the upper portion of your small intestine (the duodenum), the gallbladder squeezes bile into the small intestine through the bile ducts.

The volume of Uranus is less than one-tenth of the volume of Saturn.
(the subject does not so the science I needed so I just put biology)

Answers

The volume of Uranus is less than one-tenth of the volume of Saturn. This assertion is accurate.

What are the distinctions between Saturn and Uranus?

Despite having a smaller mass, Uranus has a slightly larger diameter than its neighbor, Neptune. Saturn is the least dense planet, making it the second least dense after that. The methane gas in Uranus' atmosphere gives the planet its bluish-green hue. The cloud tops of Uranus reflect sunlight back out of the atmosphere as it passes through them.

How similar are Saturn and Uranus?

Similarities Between Saturn and Uranus: The atmospheres of both planets are primarily made of hydrogen and helium. Each planet revolves around the Sun. Both have a core that is hotter. They both have several moons.

To learn more about volume of planets visit:

brainly.com/question/16357823

#SPJ1

A scientist collected the following data on algal growth during an experiment: Algal Growth Rates Water Temperature (°C) Time for population to double (hours) 10 69 15 58 20 36 25 44 30 52 35 71 40 78 Which of the following conclusions could be drawn from the data? A. Algae multiply most rapidly at 20°C. B. Algae multiply most slowly at 20°C. C. Algae multiply most slowly at 10°C. D. Algae multiply most rapidly at 35°C.

Answers

Based on the data provided, the conclusion that could be drawn is that algae multiply most rapidly at 35°C.

option D

What conclusions could be drawn from the data?

Looking at the data, we can see that the time for the population to double decreases as the temperature increases up until 40°C, where it reaches the lowest value of 36 hours. At 10°C, the time for population to double is 69 hours, which is the longest time of all the temperatures tested.

Therefore, we can eliminate options A and C as they suggest the opposite of what is observed in the data. Option B suggests that algae multiply most slowly at 20°C, but the data shows that algae multiply faster at this temperature than at 10°C, 25°C, and 30°C. Option D suggests that algae multiply most rapidly at 35°C.

Hence, the correct answer is that algae multiply most rapidly at 35°C.

Learn more about algae here: https://brainly.com/question/800121

#SPJ1

If having 8 repeats at loci 1 is found in 10 % of the US population, having 12 repeats at loci 2 is found in 5% of the US population, having 7 repeats at loci 3 is found in 10% of the US population, and having 5 repeats at loci 4 is found in 30% of the US population, if the US has a population of 300 million people, how many people in the US would have this DNA profile at those 4 loci?

Answers

This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci.

What is DNA?

DNA (Deoxyribonucleic acid) is a long, complex molecule that contains the genetic instructions used in the development and function of all known living organisms and many viruses. It is often described as the "blueprint" or "code" of life. DNA is composed of four types of nucleotides, which are the building blocks of the DNA molecule. Each nucleotide contains a sugar molecule, a phosphate group, and a nitrogenous base (adenine, thymine, guanine, or cytosine). The sequence of these bases along the DNA molecule determines the genetic information it carries.

Here,

To determine the number of individuals in the US population that have a specific DNA profile at these four loci, we need to multiply the percentage of individuals with each genotype at each loci. Let's start by finding the number of individuals in the US population who have 8 repeats at loci 1. We know that 10% of the US population has this genotype, so:

Number of individuals with 8 repeats at loci 1 = 10% of 300 million

= 0.1 x 300,000,000

= 30,000,000

Similarly, we can find the number of individuals with 12 repeats at loci 2:

Number of individuals with 12 repeats at loci 2 = 5% of 300 million

= 0.05 x 300,000,000

= 15,000,000

For loci 3:

Number of individuals with 7 repeats at loci 3 = 10% of 300 million

= 0.1 x 300,000,000

= 30,000,000

And finally, for loci 4:

Number of individuals with 5 repeats at loci 4 = 30% of 300 million

= 0.3 x 300,000,000

= 90,000,000

To find the number of individuals with all four of these genotypes, we need to multiply these four values:

Number of individuals with all four genotypes = 30,000,000 x 15,000,000 x 30,000,000 x 90,000,000

= 3.87 x 10²⁵

This is an astronomically large number and suggests that it is highly unlikely for any two individuals to have the same DNA profile at these four loci. In practice, forensic DNA profiling typically looks at many more loci to increase the uniqueness of the DNA profile.

To know more about DNA,

https://brainly.com/question/30396067

#SPJ9

Data that is observable and non numerical

Answers

Answer:

Observable and non-numerical data is typically referred to as qualitative data. This type of data can be descriptive or categorical and is often collected through interviews, surveys, or observations. Examples of qualitative data include the color of a flower, the texture of a fabric, or the opinions expressed by individuals in a focus group.

Explanation:

Below, a pre-mRNA is shown and the complete, edited mRNA is shown. a) in the complete mRNA, use a green pen or highlighter to highlight the methyl G cap. b) In the complete mRNA, use a red pen or highlighter to highlight the poly A tail. c) In both the pre-mRNA and complete mRNA, highlight each exon with diffeent colors, to show the pieces of pre m-RNA that are in both. Heres the pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU. Heres the complete edited mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Answers

a)Highlight the first nucleotide in green. b) Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red. c) Three exons in pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC".

What is mRNA?

Messenger ribonucleic acid is single-stranded molecule of RNA that corresponds to genetic sequence of gene.

a) Methyl G cap is added to the 5' end of the mRNA, so in the complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA",  first nucleotide is methylated guanine (methyl G) cap. Highlight the first nucleotide in green.

b) The poly A tail is added to the 3' end of mRNA, so in complete mRNA sequence "GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA", last several nucleotides are all adenine (A) nucleotides that make up the poly A tail. Highlight the last several nucleotides (usually around 100-300 A nucleotides) in red.

c) Exons are coding sequences of a gene that are kept and joined together after splicing, while introns are non-coding sequences that are removed. Based on given sequences, we can identify three exons in the pre-mRNA: "AUG", "ACCCGGGACGCGCGA", and "UGCCC". In complete mRNA, these three exons are joined together, and intron sequence "CUAUU" is removed.

To highlight exons, we can use three different colors. Let's use blue for  first exon "AUG", orange for second exon "ACCCGGGACGCGCGA", and pink for third exon "UGCCC".

In pre-mRNA: AUGAACCCGGGACGCGCGAUGCCCUAUU

Highlighted with different colors for exons:

AUGAACCCGGGACGCGCGAUGCCCUAUU

^^^^ blue ^^ orange ^^^^ pink ^^^^

In complete mRNA: GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

Highlighted with different colors for exons:

GAUGAACCGCGCGAUAUUAAAAAAAAAAAAAAAA

^^^^ blue ^^ orange ^^^^ pink ^^^^

To know more about mRNA, refer

https://brainly.com/question/24885193

#SPJ1

1. Index fossils are useful tools for geologists.
A. What information can index fossils tell geologists? (4 points)
B. What are three characteristics of a good index fossil? (6 points)

Answers

Answer:

A. Index fossils are useful tools for geologists because they can provide information about the relative age of rocks and help to correlate rock formations across different locations. By identifying and dating the age of index fossils found in a particular rock layer, geologists can determine the approximate age of the rock layer and its correlation with other rock layers in the region.

B. Three characteristics of a good index fossil are:

Widespread distribution: A good index fossil should have a wide geographic distribution, which means that it should be found in multiple locations around the world. This helps to establish a correlation between different rock layers that contain the same index fossil.

Limited time range: A good index fossil should have a limited time range, meaning that it should have existed for a relatively short period. This allows geologists to narrow down the age range of the rock layer containing the fossil.

Easily recognizable: A good index fossil should be easily recognizable, even in small or fragmented pieces. This allows geologists to quickly identify and date the fossil, even if only a small portion of it is present in the rock layer.

Overall, a good index fossil should be distinctive, easily recognizable, have a wide distribution, and a limited time range, all of which can provide useful information for geologists studying the history of the Earth.

Explanation:

An investigator studies the amount of alcohol produced by yeast when it is incubated with different types of sugars.
What would be Control treatment:

Answers

The experiment's controls include the amount of alcohol present, the incubation environment, and the varieties of yeast utilized.

how alcohol affects the body?

Digestion issues, liver illness, high cholesterol levels, heart disease, and stroke. Cancer of the rectum, liver, colon, mouth, throat, esophagus, and breast. Immune system deterioration increases the likelihood of getting sick. issues with memory and learning, including dementia, and low academic achievement.

Alcohol – a healthy beverage?

Many short- & long-term health hazards, including as blood pressure problems, violent crime, risky sexual behavior, and different malignancies, are linked to alcohol usage. The likelihood of these negative effects grows as your alcohol consumption does.

To know more about Alchohol visit:

https://brainly.com/question/11908844

#SPJ1

Describe the events in excitation contraction coupling

Answers

Answer:

cardiac contraction-excitation The sequence of occurrences, from the generation of an electrical impulse to the contraction of cardiac muscles, is referred to as coupling. This procedure is essential because it enables the heart to beat in a regulated manner without requiring conscious effort. With the help of EC coupling, the cardiac muscles sequentially contract, allowing blood to be pumped between 60 and 100 times per minute, first to the lungs and subsequently the rest of the body.

Explanation:

Which pair of cities is moving apart as a result of plate motion

Answers

Answer:

.  London, Boston pair of cities is moving apart as a result of plate motion . London situated at the Eurasian plate and Boston in the North American plate

Explanation:

8. Which process charges metamorphic rock into sedimentary ro
9. Metamorphism inches the addition of
and
to pre-existing rocks,
10. Compaction & cementation of sedmerks/forms
11. Subiecting sedimentary rocks to extreme heat & pressure forms
12. Sdfiction of molten materials forms
tocks
13. Deposition and burial of sediments forms
14, Deposited sediments may be partides of which types of rock
15. Hest & Pressure acting on igneous rocks forms
16. Solid magma forms
17.
In order to form magma, what must happen to sedimentary,
metamorphic or igneous rocks?
18. For weathering & erosion to ocour, what process will the rock
usually go through first or at the same time?

Answers

Answer:

Metamorphism does not charge metamorphic rock into sedimentary rock. Metamorphic rocks are formed from pre-existing rocks through heat and pressure, while sedimentary rocks are formed from the accumulation of sediment.

Compaction and cementation of sediments forms sedimentary rock.

Subjecting sedimentary rocks to extreme heat and pressure can form metamorphic rocks.

Solidification of molten materials forms igneous rocks.

Deposition and burial of sediments can form sedimentary rocks.

Deposited sediments may be particles of various types of rock, including igneous, metamorphic, or other sedimentary rocks.

Heat and pressure acting on igneous rocks can form metamorphic rocks.

Solidification of magma can form igneous rocks.

In order to form magma, rocks must be subjected to high temperatures and pressures, typically through the process of melting in the Earth's mantle.

For weathering and erosion to occur, the rock will usually undergo physical or chemical breakdown first, which can be caused by exposure to water, wind, or other environmental factors. This can lead to the formation of sediment that can be transported and deposited elsewhere, eventually forming sedimentary rock.

Explanation:

1 2 3 a) Supply a suitable caption for this diagram b) Give labels of the parts numbered 1, 2, and 3. c) What process takes place in these structures? d) How are these structures mentioned in question 2(a), adapted to fulfill their functions? e) Where else in the body does the process take place?​

Answers

The caption for the diagram is the respiratory system

The parts labeled 1, 2, and 3 are:

bronchiolealveolialveolar sac

What are the adaptations of the bronchiole, alveoli, and alveolar sac to their functions?

The bronchioles, alveoli, and alveolar sacs are all structures within the respiratory system that are adapted to their specific functions:

Bronchioles: The bronchioles are small, branching tubes that lead from the larger bronchi to the alveoli. They have smooth muscle fibers that can contract or relax to adjust the airflow, ensuring that air is directed to where it is needed in the lungs.

Alveoli: The alveoli are small, thin-walled sacs at the end of the bronchioles where gas exchange takes place. They have a large surface area, which is achieved through the presence of many tiny air sacs. This maximizes the amount of gas exchange that can occur.

Alveolar sacs: The alveolar sacs are clusters of alveoli that are responsible for the majority of gas exchange in the lungs. They have a shape that allows them to accommodate a large volume of air, maximizing the amount of gas exchange that can occur.

Learn more about alveoli at: https://brainly.com/question/11720309

2) Table 7.1 shows the results of a study which compared the decomposition of dead D 6.0 ASSIGNMENT-2023 Use data from table 7.1 to support your answer. 2670 Compare the enzyme activity at location A with the enzyme activity at location B.​

Answers

In comparing the enzyme activity of the two locations; at location A, the cellulase activity is higher than at location B, while the protease activity is slightly higher at location A.

What is the comparison of the two locations?

At location A, the protease activity is 2750 µmol min-1 and the cellulase activity is 4790 µmol min-1, while at location B, the protease activity is 2670 µmol min-1 and the cellulase activity is 2500 µmol min-1.

The difference in soil pH at the two locations could be due to variations in the types of vegetation, amount of rainfall, or human activities such as pollution or acid rain deposition.

The difference in soil water content at the two locations could be due to variations in the amount of rainfall, soil drainage, or the proximity to a water source such as a river or lake.

Learn more about soil pH at: https://brainly.com/question/13941039

#SPJ1

Complete question:

Table 7.1 shows the results of a study comparing the decomposition of dead leaves at two locations A and B.

                                              location A location B

protease activity / µmol min– 1 2750       2670

cellulase activity / µmol min–1 4790       2500

soil pH                                      6.0              3.5

soil water content / %              10                  77

(i) Compare the enzyme activity at location A with the enzyme activity at location B

Other Questions
a copper water tank of mass 20 kg contains 150 kg of water at 15C calculate the energy needed to heat the water and the tank to 55Ccopper shc - 385j/kgwater shc - 4200j/kg Professor Yi, M.A. is an expert on mindfulness meditation, and completed a study on how this practice can reduce stress. In the untreated population of Ionia, stress levels as measured by the HRSI (higher values indicate higher levels of stress) the mean stress level is = 30 and = 12. Professor Yi obtained a sample of n = 16 students to teach mindfulness meditation to for two months. After the two months of lessons the students show average HRSI stress scores of M = 24. Yi decided in advance he was going to run a two-tailed hypothesis test at an = .05.What is the null hypothesis for this study? What is the purpose of a claim in an analytical essay that explicates a poem?A. To make readers accept your interpretation of the poem. B. To theorize about how elements of the poem work. C. To transition from one part of the essay to the next. D. To explain the historical context of the poem Determining Whether a Point Lies on a Circle108-10 8-6-4-2642-2-68-10Y26 8 10A circle centered at the origin contains the point(0, -9). Does (8, 17) also lie on the circle? Explain.O No, the distance from the center to the point(8, 17) is not the same as the radius.O No, the radius of 10 units is different from thedistance from the center to the point(8. 17).O Yes, the distance from the origin to the point(8,17) is 9 units.Yes, the distance from the point (0, -9) to the point(8, 17) is 9 units. The dimensions of a rectangular prism are 1.5 feet by 6 feet, by 2 feet. What is the volume of the rectangular prism? Pls need help PLEASE HURRY!!! I WILL GIVE THE BRAINLIEST!!!Which answer shows the correct steps to solve the equation aSubtract 4 from both sides,, multiply by 12 on both sides, subtract 10 from both sides, and divide both sides by 5 to get x=2/5 bMultiply by 15 on both sides, subtract by 10 on both sides, and divide by 5 on both sides to get x=10 cSubtract 10 from both sides, multiply by 15 on both sides, and divide by 5 to get x=(-18) dSubtract 5x from both sides, subtract 10/15 from both sides, and divide both sides by 5 to get x=10 mention three reasons why protesters in an advocacy campaign should avoid using violence during their protest AP WORLD:you dont need to give me the full answer just notesHow did countries borders change from 1900 to the present, and which borders stayed the same? michelle works with the human resource information system vendor to identify and explain business processes. she notices this results in improved processes as they work through data flow diagrams. this design factor is called a block exerts a force of 7nm on the ground. what is the pressure on the ground in nm2 when its flat on the grounds the area of its base is 0.04m2 You see a 45-day T-bill with a price of $9,962.17. What would bethis T-bills bond equivalent yield (BEY)?Group of answer choices 3.08% 2.31% 2.77% 2.52% Please help meee this is due Friday!!! A fully loaded and fueled spacecraft can weigh close to 5.1 million pounds. What is this weight converted to tons? if f(x)=2x+3 and g(x)=x-7 find (f+g)(x) GivensMolar mass H2SO4 = 98.07 g/molMolar mass Li3PO4 = 115.78 g/mol3H2SO4 + 2Li3PO4 --> 2H3PO4 + 3Li2SO4If 44 g H2SO4 need to react, how many grams of Li3PO4 need to be used? Who worked for economic empowerment the black panthers or SNCC? some policymakers and environmental scientists would like to see the united states cut back on its use of oil in the long run. we can use this elasticity estimate to get a rough measure of how high the price of oil would have to rise in order to get people to make big cuts in oil consumption. how much would a permanent rise in the price of oil have to be to cut oil consumption by 50%? are the parts of a word that have meaning and can be used tounderstand other words. simplify and find the value of 3(a square +5ab) -5a squared - 12ab , a = 2 & b = 3 If the elements cobalt and bromine were mixed and heated, they would combine intoa solid ionic compound. The name of the compound is Its formula is which shape of prokaryotic cell normally does not exist as one single cell, but is instead found in groups of cells with specific names based on their arrangement? multiple choice rod-shaped (bacilli) spherical (coccus) spiral (spirochetes)